Incidental Mutation 'R1071:Ugt3a2'
ID86202
Institutional Source Beutler Lab
Gene Symbol Ugt3a2
Ensembl Gene ENSMUSG00000049152
Gene NameUDP glycosyltransferases 3 family, polypeptide A2
Synonyms
MMRRC Submission 039157-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1071 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location9335550-9370955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9367368 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 399 (V399A)
Ref Sequence ENSEMBL: ENSMUSP00000072236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072403]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072403
AA Change: V399A

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072236
Gene: ENSMUSG00000049152
AA Change: V399A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:UDPGT 23 521 1.1e-99 PFAM
Pfam:Glyco_tran_28_C 307 450 1.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144755
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,218,426 H1486Q probably benign Het
Apc2 T C 10: 80,311,502 S768P probably damaging Het
Bub1b CAT C 2: 118,632,447 probably null Het
Eml4 G T 17: 83,478,039 E878* probably null Het
Plcb1 A G 2: 135,325,657 D457G possibly damaging Het
Prepl T C 17: 85,070,512 Y480C probably damaging Het
Senp6 T A 9: 80,136,729 Y708N probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vmn1r30 A T 6: 58,435,828 N6K possibly damaging Het
Vmn2r3 G A 3: 64,275,276 T334I possibly damaging Het
Vtn C A 11: 78,501,776 N393K probably benign Het
Zfp786 T C 6: 47,821,305 D233G possibly damaging Het
Zmym2 A G 14: 56,959,821 T1349A possibly damaging Het
Other mutations in Ugt3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Ugt3a2 APN 15 9367268 missense probably damaging 0.99
IGL01131:Ugt3a2 APN 15 9365162 missense probably damaging 1.00
IGL01627:Ugt3a2 APN 15 9335720 missense probably damaging 1.00
IGL01746:Ugt3a2 APN 15 9361668 missense probably damaging 1.00
IGL01949:Ugt3a2 APN 15 9335729 missense probably damaging 1.00
IGL02213:Ugt3a2 APN 15 9370224 missense probably benign 0.00
IGL02407:Ugt3a2 APN 15 9365230 nonsense probably null
IGL02588:Ugt3a2 APN 15 9361456 missense probably benign
IGL02894:Ugt3a2 APN 15 9367401 missense probably damaging 1.00
IGL02966:Ugt3a2 APN 15 9370068 missense probably damaging 1.00
IGL03385:Ugt3a2 APN 15 9338738 missense probably damaging 0.99
IGL03493:Ugt3a2 APN 15 9361483 missense probably damaging 0.96
R0554:Ugt3a2 UTSW 15 9351120 missense probably benign 0.14
R0833:Ugt3a2 UTSW 15 9370150 missense probably damaging 0.96
R1513:Ugt3a2 UTSW 15 9361524 missense probably benign 0.07
R1844:Ugt3a2 UTSW 15 9351168 missense probably benign 0.07
R1874:Ugt3a2 UTSW 15 9365351 missense probably damaging 1.00
R2305:Ugt3a2 UTSW 15 9351117 missense probably benign
R3052:Ugt3a2 UTSW 15 9365288 missense probably damaging 1.00
R3755:Ugt3a2 UTSW 15 9367412 missense probably benign 0.21
R3945:Ugt3a2 UTSW 15 9370098 missense possibly damaging 0.91
R4135:Ugt3a2 UTSW 15 9338724 missense probably damaging 0.98
R4261:Ugt3a2 UTSW 15 9335793 splice site probably null
R4438:Ugt3a2 UTSW 15 9351197 missense probably benign 0.01
R4570:Ugt3a2 UTSW 15 9338721 missense probably benign 0.12
R4791:Ugt3a2 UTSW 15 9361579 missense probably damaging 1.00
R4957:Ugt3a2 UTSW 15 9365188 missense probably benign 0.27
R5011:Ugt3a2 UTSW 15 9365287 missense probably damaging 1.00
R5035:Ugt3a2 UTSW 15 9361618 missense probably benign 0.01
R5554:Ugt3a2 UTSW 15 9370201 missense probably damaging 1.00
R5573:Ugt3a2 UTSW 15 9361683 missense probably damaging 1.00
R5631:Ugt3a2 UTSW 15 9361885 missense probably damaging 0.98
R5696:Ugt3a2 UTSW 15 9361448 splice site silent
R6265:Ugt3a2 UTSW 15 9361579 missense probably damaging 1.00
R6302:Ugt3a2 UTSW 15 9365311 missense probably damaging 1.00
R6311:Ugt3a2 UTSW 15 9361518 nonsense probably null
R6680:Ugt3a2 UTSW 15 9370068 missense probably damaging 1.00
R8229:Ugt3a2 UTSW 15 9367377 missense probably damaging 0.99
R8296:Ugt3a2 UTSW 15 9361938 missense probably benign 0.18
Z1177:Ugt3a2 UTSW 15 9367257 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTCTGCTGCTTTACCTAGTATCTGACG -3'
(R):5'- GGGCCTTCAAGTACCACACACTTATT -3'

Sequencing Primer
(F):5'- CGCTTCCATAGTGAAATCTTGGAC -3'
(R):5'- TCTAGTTTCACTGGAAAACAGACAAC -3'
Posted On2013-11-18