Incidental Mutation 'R1036:Nif3l1'
ID93763
Institutional Source Beutler Lab
Gene Symbol Nif3l1
Ensembl Gene ENSMUSG00000026036
Gene NameNgg1 interacting factor 3-like 1 (S. pombe)
Synonyms
MMRRC Submission 039135-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.344) question?
Stock #R1036 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58445151-58481816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58447873 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 73 (T73A)
Ref Sequence ENSEMBL: ENSMUSP00000127501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081677] [ENSMUST00000087521] [ENSMUST00000114337] [ENSMUST00000114345] [ENSMUST00000114348] [ENSMUST00000117069] [ENSMUST00000129759] [ENSMUST00000151272] [ENSMUST00000171597] [ENSMUST00000185990] [ENSMUST00000190048]
Predicted Effect probably benign
Transcript: ENSMUST00000081677
SMART Domains Protein: ENSMUSP00000080378
Gene: ENSMUSG00000026035

DomainStartEndE-ValueType
Pfam:Pro_isomerase 2 154 3.9e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000087521
AA Change: T73A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084799
Gene: ENSMUSG00000026036
AA Change: T73A

DomainStartEndE-ValueType
Pfam:NIF3 31 363 1.9e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114337
AA Change: T73A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109976
Gene: ENSMUSG00000026036
AA Change: T73A

DomainStartEndE-ValueType
Pfam:NIF3 31 324 4e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114345
SMART Domains Protein: ENSMUSP00000109984
Gene: ENSMUSG00000026035

DomainStartEndE-ValueType
Pfam:Pro_isomerase 2 120 8.5e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114348
SMART Domains Protein: ENSMUSP00000109988
Gene: ENSMUSG00000026035

DomainStartEndE-ValueType
Pfam:Pro_isomerase 2 154 3.9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117069
SMART Domains Protein: ENSMUSP00000112947
Gene: ENSMUSG00000026035

DomainStartEndE-ValueType
Pfam:Pro_isomerase 2 154 5.2e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124550
Predicted Effect probably damaging
Transcript: ENSMUST00000129759
AA Change: T73A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124713
Gene: ENSMUSG00000026036
AA Change: T73A

DomainStartEndE-ValueType
Pfam:NIF3 31 154 2e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140723
Predicted Effect probably damaging
Transcript: ENSMUST00000151272
AA Change: T73A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123553
Gene: ENSMUSG00000026036
AA Change: T73A

DomainStartEndE-ValueType
Pfam:NIF3 31 131 3.1e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171597
AA Change: T73A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127501
Gene: ENSMUSG00000026036
AA Change: T73A

DomainStartEndE-ValueType
Pfam:NIF3 31 363 2.5e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185990
SMART Domains Protein: ENSMUSP00000139979
Gene: ENSMUSG00000026035

DomainStartEndE-ValueType
Pfam:Pro_isomerase 2 90 1.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190048
SMART Domains Protein: ENSMUSP00000139617
Gene: ENSMUSG00000026035

DomainStartEndE-ValueType
Pfam:Pro_isomerase 2 91 3.1e-27 PFAM
Meta Mutation Damage Score 0.8520 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 86.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene is a member of the NGG1-interacting factor 3-like superfamily of transcriptional regulators and is ubiquitously expressed throughout embryonic development. The encoded protein interacts with a component of the constitutive photomorphogenesis 9 signalosome, and functions as a transcriptional corepressor of genes involved in neuronal differentiation. This gene is highly conserved from bacteria to human. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abca12 A G 1: 71,263,410 probably null Het
Abcg1 C A 17: 31,111,269 Q515K probably damaging Het
Acaa1b A T 9: 119,150,816 probably benign Het
Adamts3 T C 5: 89,696,093 probably benign Het
Aoah A C 13: 20,840,169 probably benign Het
Arhgap10 G A 8: 77,310,769 P610L probably damaging Het
Casq2 G T 3: 102,142,215 A295S probably damaging Het
Col6a4 A G 9: 106,068,198 Y906H probably damaging Het
Dcaf13 T A 15: 39,143,718 I349N probably damaging Het
Ecd A G 14: 20,333,318 probably benign Het
Enpep C A 3: 129,284,109 V620L probably damaging Het
Fbln7 A G 2: 128,893,895 S268G possibly damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Gatd1 T A 7: 141,409,132 T205S probably damaging Het
Gbe1 T A 16: 70,528,887 V604E probably damaging Het
Ghsr T A 3: 27,374,720 I298N probably damaging Het
Glis1 T C 4: 107,632,264 Y683H probably benign Het
Gm597 A G 1: 28,777,802 L383P probably benign Het
Gpr162 T A 6: 124,860,860 I276F probably damaging Het
Hps6 A G 19: 46,004,241 T206A probably benign Het
Kcnk10 T C 12: 98,496,186 probably benign Het
Krt90 A G 15: 101,562,716 V37A probably benign Het
Lmbr1 T C 5: 29,258,747 K160E probably damaging Het
Nup107 A T 10: 117,757,294 D826E probably damaging Het
Nup210l C T 3: 90,192,940 probably benign Het
Omd A G 13: 49,589,971 R166G probably damaging Het
Plekha4 T C 7: 45,549,976 probably benign Het
Ptgdr A G 14: 44,859,115 S47P probably damaging Het
Sec24c A G 14: 20,692,897 I940V probably benign Het
Shkbp1 A G 7: 27,345,296 S457P possibly damaging Het
Skint1 T C 4: 112,019,296 V138A possibly damaging Het
Slc38a9 A G 13: 112,701,659 probably benign Het
Srsf7 A T 17: 80,205,837 probably benign Het
Stau1 T C 2: 166,951,315 K300R probably damaging Het
Stox1 A T 10: 62,667,895 I127K probably damaging Het
Sympk G A 7: 19,048,453 R832Q probably damaging Het
Usp3 A G 9: 66,530,231 probably benign Het
Other mutations in Nif3l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Nif3l1 APN 1 58455686 missense possibly damaging 0.56
IGL01657:Nif3l1 APN 1 58455612 missense probably damaging 0.98
IGL02159:Nif3l1 APN 1 58447946 unclassified probably null
IGL02223:Nif3l1 APN 1 58448043 nonsense probably null
IGL02407:Nif3l1 APN 1 58457797 missense possibly damaging 0.87
IGL02435:Nif3l1 APN 1 58447861 missense possibly damaging 0.91
IGL02676:Nif3l1 APN 1 58455736 critical splice donor site probably null
IGL02721:Nif3l1 APN 1 58457849 missense probably damaging 1.00
R0472:Nif3l1 UTSW 1 58447828 missense probably damaging 1.00
R1256:Nif3l1 UTSW 1 58455649 missense probably damaging 0.99
R1439:Nif3l1 UTSW 1 58447943 missense probably damaging 1.00
R1483:Nif3l1 UTSW 1 58447726 missense probably benign 0.01
R2240:Nif3l1 UTSW 1 58452129 missense probably benign 0.35
R4379:Nif3l1 UTSW 1 58455579 intron probably benign
R4381:Nif3l1 UTSW 1 58455579 intron probably benign
R4552:Nif3l1 UTSW 1 58449324 unclassified probably benign
R6524:Nif3l1 UTSW 1 58457840 missense probably benign 0.01
R6567:Nif3l1 UTSW 1 58455630 missense probably benign 0.13
R6698:Nif3l1 UTSW 1 58450489 missense probably benign 0.01
R7254:Nif3l1 UTSW 1 58450466 missense probably benign 0.01
R7841:Nif3l1 UTSW 1 58447883 missense probably damaging 1.00
R7924:Nif3l1 UTSW 1 58447883 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAAGTGTGCAACGTGCCCAG -3'
(R):5'- GGACAAGAGTTTTCTCACCAAGCCC -3'

Sequencing Primer
(F):5'- CAACGTGCCCAGTCGTG -3'
(R):5'- TGGGGTGCCGCATCATAG -3'
Posted On2014-01-05