Incidental Mutation 'R1036:Stau1'
ID 93772
Institutional Source Beutler Lab
Gene Symbol Stau1
Ensembl Gene ENSMUSG00000039536
Gene Name staufen double-stranded RNA binding protein 1
Synonyms 5830401L18Rik
MMRRC Submission 039135-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1036 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 166789469-166838219 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 166793235 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 300 (K300R)
Ref Sequence ENSEMBL: ENSMUSP00000139039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000049412] [ENSMUST00000109235] [ENSMUST00000109236] [ENSMUST00000109238] [ENSMUST00000184390]
AlphaFold Q9Z108
Predicted Effect probably benign
Transcript: ENSMUST00000002790
SMART Domains Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 526 9.2e-169 PFAM
Pfam:CAS_CSE1 527 962 1.1e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049412
AA Change: K294R

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000042626
Gene: ENSMUSG00000039536
AA Change: K294R

DomainStartEndE-ValueType
Blast:DSRM 1 73 5e-21 BLAST
DSRM 97 162 9.49e-21 SMART
DSRM 199 265 5.54e-22 SMART
PDB:4DKK|A 355 469 2e-69 PDB
Blast:DSRM 401 466 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109235
AA Change: K294R

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104858
Gene: ENSMUSG00000039536
AA Change: K294R

DomainStartEndE-ValueType
Blast:DSRM 1 73 5e-21 BLAST
DSRM 97 162 9.49e-21 SMART
DSRM 199 265 5.54e-22 SMART
PDB:4DKK|A 355 469 3e-69 PDB
Blast:DSRM 401 466 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109236
AA Change: K292R

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104859
Gene: ENSMUSG00000039536
AA Change: K292R

DomainStartEndE-ValueType
Blast:DSRM 1 73 4e-21 BLAST
DSRM 97 162 9.49e-21 SMART
DSRM 197 263 5.54e-22 SMART
PDB:4DKK|A 353 467 3e-69 PDB
Blast:DSRM 399 464 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109238
AA Change: K300R

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104861
Gene: ENSMUSG00000039536
AA Change: K300R

DomainStartEndE-ValueType
Blast:DSRM 1 73 5e-21 BLAST
DSRM 97 168 4.04e-15 SMART
DSRM 205 271 5.54e-22 SMART
Pfam:Staufen_C 364 475 5.9e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130790
Predicted Effect probably damaging
Transcript: ENSMUST00000184390
AA Change: K300R

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139039
Gene: ENSMUSG00000039536
AA Change: K300R

DomainStartEndE-ValueType
Blast:DSRM 1 73 4e-21 BLAST
DSRM 97 168 4.04e-15 SMART
DSRM 205 271 5.54e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149454
Meta Mutation Damage Score 0.0921 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 86.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Staufen is a member of the family of double-stranded RNA (dsRNA)-binding proteins involved in the transport and/or localization of mRNAs to different subcellular compartments and/or organelles. These proteins are characterized by the presence of multiple dsRNA-binding domains which are required to bind RNAs having double-stranded secondary structures. The human homologue of staufen encoded by STAU, in addition contains a microtubule- binding domain similar to that of microtubule-associated protein 1B, and binds tubulin. The STAU gene product has been shown to be present in the cytoplasm in association with the rough endoplasmic reticulum (RER), implicating this protein in the transport of mRNA via the microtubule network to the RER, the site of translation. Five transcript variants resulting from alternative splicing of STAU gene and encoding three isoforms have been described. Three of these variants encode the same isoform, however, differ in their 5'UTR. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit hypoactivity and impaired dendrite outgrowth and spine formation. [provided by MGI curators]
Allele List at MGI

All alleles(55) : Targeted, other(1) Gene trapped(54)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 77,024,130 (GRCm39) T174M probably damaging Het
Abca12 A G 1: 71,302,569 (GRCm39) probably null Het
Abcg1 C A 17: 31,330,243 (GRCm39) Q515K probably damaging Het
Acaa1b A T 9: 118,979,884 (GRCm39) probably benign Het
Adamts3 T C 5: 89,843,952 (GRCm39) probably benign Het
Aoah A C 13: 21,024,339 (GRCm39) probably benign Het
Arhgap10 G A 8: 78,037,398 (GRCm39) P610L probably damaging Het
Casq2 G T 3: 102,049,531 (GRCm39) A295S probably damaging Het
Col6a4 A G 9: 105,945,397 (GRCm39) Y906H probably damaging Het
Dcaf13 T A 15: 39,007,113 (GRCm39) I349N probably damaging Het
Ecd A G 14: 20,383,386 (GRCm39) probably benign Het
Enpep C A 3: 129,077,758 (GRCm39) V620L probably damaging Het
Fbln7 A G 2: 128,735,815 (GRCm39) S268G possibly damaging Het
Fcho1 C T 8: 72,165,204 (GRCm39) A418T probably benign Het
Gatd1 T A 7: 140,989,045 (GRCm39) T205S probably damaging Het
Gbe1 T A 16: 70,325,775 (GRCm39) V604E probably damaging Het
Ghsr T A 3: 27,428,869 (GRCm39) I298N probably damaging Het
Glis1 T C 4: 107,489,461 (GRCm39) Y683H probably benign Het
Gpr162 T A 6: 124,837,823 (GRCm39) I276F probably damaging Het
Hps6 A G 19: 45,992,680 (GRCm39) T206A probably benign Het
Kcnk10 T C 12: 98,462,445 (GRCm39) probably benign Het
Krt90 A G 15: 101,471,151 (GRCm39) V37A probably benign Het
Lmbr1 T C 5: 29,463,745 (GRCm39) K160E probably damaging Het
Nif3l1 A G 1: 58,487,032 (GRCm39) T73A probably damaging Het
Nup107 A T 10: 117,593,199 (GRCm39) D826E probably damaging Het
Nup210l C T 3: 90,100,247 (GRCm39) probably benign Het
Omd A G 13: 49,743,447 (GRCm39) R166G probably damaging Het
Plekha4 T C 7: 45,199,400 (GRCm39) probably benign Het
Ptgdr A G 14: 45,096,572 (GRCm39) S47P probably damaging Het
Sec24c A G 14: 20,742,965 (GRCm39) I940V probably benign Het
Shkbp1 A G 7: 27,044,721 (GRCm39) S457P possibly damaging Het
Skint1 T C 4: 111,876,493 (GRCm39) V138A possibly damaging Het
Slc38a9 A G 13: 112,838,193 (GRCm39) probably benign Het
Spata31e5 A G 1: 28,816,883 (GRCm39) L383P probably benign Het
Srsf7 A T 17: 80,513,266 (GRCm39) probably benign Het
Stox1 A T 10: 62,503,674 (GRCm39) I127K probably damaging Het
Sympk G A 7: 18,782,378 (GRCm39) R832Q probably damaging Het
Usp3 A G 9: 66,437,513 (GRCm39) probably benign Het
Other mutations in Stau1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Stau1 APN 2 166,792,729 (GRCm39) missense probably benign 0.03
IGL00531:Stau1 APN 2 166,806,542 (GRCm39) missense probably benign 0.00
IGL00553:Stau1 APN 2 166,793,254 (GRCm39) missense possibly damaging 0.88
IGL02311:Stau1 APN 2 166,792,239 (GRCm39) missense probably damaging 1.00
IGL02558:Stau1 APN 2 166,792,768 (GRCm39) missense probably benign 0.10
IGL02746:Stau1 APN 2 166,796,818 (GRCm39) critical splice donor site probably null
IGL02797:Stau1 APN 2 166,791,266 (GRCm39) makesense probably null
IGL03308:Stau1 APN 2 166,792,240 (GRCm39) missense probably damaging 1.00
D4216:Stau1 UTSW 2 166,791,670 (GRCm39) missense probably benign
R0614:Stau1 UTSW 2 166,792,726 (GRCm39) missense probably damaging 1.00
R2935:Stau1 UTSW 2 166,797,037 (GRCm39) missense probably benign 0.00
R3078:Stau1 UTSW 2 166,796,936 (GRCm39) missense possibly damaging 0.68
R4542:Stau1 UTSW 2 166,795,181 (GRCm39) missense probably damaging 1.00
R4778:Stau1 UTSW 2 166,805,442 (GRCm39) missense probably benign 0.00
R6397:Stau1 UTSW 2 166,792,927 (GRCm39) missense possibly damaging 0.83
R7208:Stau1 UTSW 2 166,805,494 (GRCm39) missense probably damaging 0.98
R7870:Stau1 UTSW 2 166,792,870 (GRCm39) missense possibly damaging 0.89
R7877:Stau1 UTSW 2 166,792,787 (GRCm39) missense possibly damaging 0.95
R8844:Stau1 UTSW 2 166,793,266 (GRCm39) missense probably benign 0.00
R9174:Stau1 UTSW 2 166,791,269 (GRCm39) missense probably damaging 0.99
R9353:Stau1 UTSW 2 166,792,267 (GRCm39) missense probably damaging 1.00
R9410:Stau1 UTSW 2 166,797,038 (GRCm39) missense probably benign
R9784:Stau1 UTSW 2 166,791,695 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAAGGCATCCTGAACTCCTCGTCC -3'
(R):5'- GTGCAGACCCTACTTTCCCAACAAG -3'

Sequencing Primer
(F):5'- GGGACACAGGTCACCAAAGTC -3'
(R):5'- AAGCTGAACACTTTTAAGCCAG -3'
Posted On 2014-01-05