Incidental Mutation 'R1036:Glis1'
ID 93778
Institutional Source Beutler Lab
Gene Symbol Glis1
Ensembl Gene ENSMUSG00000034762
Gene Name GLIS family zinc finger 1
Synonyms GliH1
MMRRC Submission 039135-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1036 (G1)
Quality Score 198
Status Validated
Chromosome 4
Chromosomal Location 107291788-107492258 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107489461 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 683 (Y683H)
Ref Sequence ENSEMBL: ENSMUSP00000035650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046005] [ENSMUST00000106738]
AlphaFold Q8K1M4
Predicted Effect probably benign
Transcript: ENSMUST00000046005
AA Change: Y683H

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000035650
Gene: ENSMUSG00000034762
AA Change: Y683H

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
low complexity region 118 129 N/A INTRINSIC
low complexity region 242 255 N/A INTRINSIC
low complexity region 274 288 N/A INTRINSIC
low complexity region 334 357 N/A INTRINSIC
ZnF_C2H2 366 391 3.99e0 SMART
ZnF_C2H2 400 427 4.12e0 SMART
ZnF_C2H2 433 457 7.78e-3 SMART
ZnF_C2H2 463 487 1.45e-2 SMART
ZnF_C2H2 493 517 5.59e-4 SMART
low complexity region 543 557 N/A INTRINSIC
low complexity region 635 658 N/A INTRINSIC
low complexity region 666 686 N/A INTRINSIC
low complexity region 721 735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106738
AA Change: Y495H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000102349
Gene: ENSMUSG00000034762
AA Change: Y495H

DomainStartEndE-ValueType
low complexity region 54 67 N/A INTRINSIC
low complexity region 86 100 N/A INTRINSIC
low complexity region 146 169 N/A INTRINSIC
ZnF_C2H2 178 203 3.99e0 SMART
ZnF_C2H2 212 239 4.12e0 SMART
ZnF_C2H2 245 269 7.78e-3 SMART
ZnF_C2H2 275 299 1.45e-2 SMART
ZnF_C2H2 305 329 5.59e-4 SMART
low complexity region 355 369 N/A INTRINSIC
low complexity region 447 470 N/A INTRINSIC
low complexity region 478 498 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138211
Meta Mutation Damage Score 0.0589 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 86.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GLIS1 is a GLI (MIM 165220)-related Kruppel-like zinc finger protein that functions as an activator and repressor of transcription (Kim et al., 2002 [PubMed 12042312]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mice do not exhibit any overt abnormalities, including behavior, kidney or tooth morphology, up to 6 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 77,024,130 (GRCm39) T174M probably damaging Het
Abca12 A G 1: 71,302,569 (GRCm39) probably null Het
Abcg1 C A 17: 31,330,243 (GRCm39) Q515K probably damaging Het
Acaa1b A T 9: 118,979,884 (GRCm39) probably benign Het
Adamts3 T C 5: 89,843,952 (GRCm39) probably benign Het
Aoah A C 13: 21,024,339 (GRCm39) probably benign Het
Arhgap10 G A 8: 78,037,398 (GRCm39) P610L probably damaging Het
Casq2 G T 3: 102,049,531 (GRCm39) A295S probably damaging Het
Col6a4 A G 9: 105,945,397 (GRCm39) Y906H probably damaging Het
Dcaf13 T A 15: 39,007,113 (GRCm39) I349N probably damaging Het
Ecd A G 14: 20,383,386 (GRCm39) probably benign Het
Enpep C A 3: 129,077,758 (GRCm39) V620L probably damaging Het
Fbln7 A G 2: 128,735,815 (GRCm39) S268G possibly damaging Het
Fcho1 C T 8: 72,165,204 (GRCm39) A418T probably benign Het
Gatd1 T A 7: 140,989,045 (GRCm39) T205S probably damaging Het
Gbe1 T A 16: 70,325,775 (GRCm39) V604E probably damaging Het
Ghsr T A 3: 27,428,869 (GRCm39) I298N probably damaging Het
Gpr162 T A 6: 124,837,823 (GRCm39) I276F probably damaging Het
Hps6 A G 19: 45,992,680 (GRCm39) T206A probably benign Het
Kcnk10 T C 12: 98,462,445 (GRCm39) probably benign Het
Krt90 A G 15: 101,471,151 (GRCm39) V37A probably benign Het
Lmbr1 T C 5: 29,463,745 (GRCm39) K160E probably damaging Het
Nif3l1 A G 1: 58,487,032 (GRCm39) T73A probably damaging Het
Nup107 A T 10: 117,593,199 (GRCm39) D826E probably damaging Het
Nup210l C T 3: 90,100,247 (GRCm39) probably benign Het
Omd A G 13: 49,743,447 (GRCm39) R166G probably damaging Het
Plekha4 T C 7: 45,199,400 (GRCm39) probably benign Het
Ptgdr A G 14: 45,096,572 (GRCm39) S47P probably damaging Het
Sec24c A G 14: 20,742,965 (GRCm39) I940V probably benign Het
Shkbp1 A G 7: 27,044,721 (GRCm39) S457P possibly damaging Het
Skint1 T C 4: 111,876,493 (GRCm39) V138A possibly damaging Het
Slc38a9 A G 13: 112,838,193 (GRCm39) probably benign Het
Spata31e5 A G 1: 28,816,883 (GRCm39) L383P probably benign Het
Srsf7 A T 17: 80,513,266 (GRCm39) probably benign Het
Stau1 T C 2: 166,793,235 (GRCm39) K300R probably damaging Het
Stox1 A T 10: 62,503,674 (GRCm39) I127K probably damaging Het
Sympk G A 7: 18,782,378 (GRCm39) R832Q probably damaging Het
Usp3 A G 9: 66,437,513 (GRCm39) probably benign Het
Other mutations in Glis1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Glis1 APN 4 107,484,758 (GRCm39) missense probably benign 0.01
IGL02450:Glis1 APN 4 107,484,726 (GRCm39) missense probably benign 0.25
IGL03167:Glis1 APN 4 107,293,102 (GRCm39) missense possibly damaging 0.90
IGL03189:Glis1 APN 4 107,472,248 (GRCm39) missense probably damaging 1.00
IGL03377:Glis1 APN 4 107,489,478 (GRCm39) missense probably damaging 0.98
glenys UTSW 4 107,484,740 (GRCm39) missense possibly damaging 0.91
R0551:Glis1 UTSW 4 107,425,316 (GRCm39) splice site probably null
R0981:Glis1 UTSW 4 107,472,239 (GRCm39) missense probably damaging 1.00
R1527:Glis1 UTSW 4 107,425,123 (GRCm39) missense probably damaging 0.96
R1741:Glis1 UTSW 4 107,425,544 (GRCm39) missense probably damaging 1.00
R2937:Glis1 UTSW 4 107,489,488 (GRCm39) missense possibly damaging 0.89
R2938:Glis1 UTSW 4 107,489,488 (GRCm39) missense possibly damaging 0.89
R4223:Glis1 UTSW 4 107,425,042 (GRCm39) missense probably benign 0.01
R4412:Glis1 UTSW 4 107,491,915 (GRCm39) missense probably damaging 0.99
R4587:Glis1 UTSW 4 107,484,740 (GRCm39) missense possibly damaging 0.91
R4685:Glis1 UTSW 4 107,424,842 (GRCm39) missense probably benign 0.00
R4900:Glis1 UTSW 4 107,476,761 (GRCm39) missense probably damaging 1.00
R5138:Glis1 UTSW 4 107,480,302 (GRCm39) frame shift probably null
R5167:Glis1 UTSW 4 107,491,891 (GRCm39) missense probably damaging 1.00
R5511:Glis1 UTSW 4 107,293,074 (GRCm39) missense probably damaging 0.99
R5568:Glis1 UTSW 4 107,476,832 (GRCm39) missense probably damaging 0.99
R5807:Glis1 UTSW 4 107,425,279 (GRCm39) missense probably benign 0.00
R6006:Glis1 UTSW 4 107,425,103 (GRCm39) missense probably damaging 1.00
R6180:Glis1 UTSW 4 107,484,710 (GRCm39) missense probably benign 0.06
R6219:Glis1 UTSW 4 107,489,102 (GRCm39) missense probably benign 0.27
R6856:Glis1 UTSW 4 107,293,076 (GRCm39) missense probably damaging 0.96
R7278:Glis1 UTSW 4 107,292,880 (GRCm39) start codon destroyed probably null 0.53
R7877:Glis1 UTSW 4 107,491,900 (GRCm39) missense probably damaging 1.00
R7937:Glis1 UTSW 4 107,484,723 (GRCm39) missense possibly damaging 0.68
R7940:Glis1 UTSW 4 107,489,572 (GRCm39) missense probably damaging 0.99
R7940:Glis1 UTSW 4 107,489,571 (GRCm39) missense probably damaging 1.00
R7954:Glis1 UTSW 4 107,476,854 (GRCm39) missense possibly damaging 0.82
R8078:Glis1 UTSW 4 107,425,099 (GRCm39) missense probably damaging 1.00
R8931:Glis1 UTSW 4 107,421,060 (GRCm39) missense probably benign 0.35
R9227:Glis1 UTSW 4 107,425,327 (GRCm39) missense probably benign 0.45
R9230:Glis1 UTSW 4 107,425,327 (GRCm39) missense probably benign 0.45
R9767:Glis1 UTSW 4 107,491,794 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTATCGGCCACAGACTTTAGCAGG -3'
(R):5'- GGTAGACTGGGCTTCTTCAAGCTTC -3'

Sequencing Primer
(F):5'- GGCCTTCACCTTTCCTGTG -3'
(R):5'- CCAGCCTTGGTAGTGTTCAG -3'
Posted On 2014-01-05