Mutagenetix > Incidental Mutations

Incidental Mutation 'R1036:Sympk'

93791

Institutional Source

Beutler Lab

Gene Symbol

Sympk

Ensembl Gene

ENSMUSG00000023118

Gene Name

symplekin

Synonyms

MMRRC Submission

039135-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.968) question?

Stock #

R1036 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

19024377-19054618 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 19048453 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 832 (R832Q)

Ref Sequence

ENSEMBL: ENSMUSP00000023882 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023882] [ENSMUST00000146903]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023882
AA Change: R832Q

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000023882
Gene: ENSMUSG00000023118
AA Change: R832Q

Domain	Start	End	E-Value	Type
low complexity region	106	118	N/A	INTRINSIC
Pfam:DUF3453	119	352	1.1e-63	PFAM
low complexity region	473	485	N/A	INTRINSIC
Pfam:Symplekin_C	887	1068	4.3e-78	PFAM
low complexity region	1123	1149	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130328

SMART Domains

Protein: ENSMUSP00000115900
Gene: ENSMUSG00000023118

Domain	Start	End	E-Value	Type
Pfam:Symplekin_C	1	92	3.9e-44	PFAM
low complexity region	125	143	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131230

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138440

Predicted Effect

probably benign
Transcript: ENSMUST00000146903

SMART Domains

Protein: ENSMUSP00000138740
Gene: ENSMUSG00000023118

Domain	Start	End	E-Value	Type
Pfam:DUF3453	117	230	1.1e-35	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148861

Meta Mutation Damage Score

0.1188

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 94.7%
20x: 86.2%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that functions in the regulation of polyadenylation and promotes gene expression. The protein forms a high-molecular weight complex with components of the polyadenylation machinery. It is thought to serve as a scaffold for recruiting regulatory factors to the polyadenylation complex. It also participates in 3'-end maturation of histone mRNAs, which do not undergo polyadenylation. The protein also localizes to the cytoplasmic plaques of tight junctions in some cell types. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous ofr a transgenic gene disruption exhibit anemia at E15 and hydrops fetalis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	G	A	5: 76,876,283	T174M	probably damaging	Het
Abca12	A	G	1: 71,263,410		probably null	Het
Abcg1	C	A	17: 31,111,269	Q515K	probably damaging	Het
Acaa1b	A	T	9: 119,150,816		probably benign	Het
Adamts3	T	C	5: 89,696,093		probably benign	Het
Aoah	A	C	13: 20,840,169		probably benign	Het
Arhgap10	G	A	8: 77,310,769	P610L	probably damaging	Het
Casq2	G	T	3: 102,142,215	A295S	probably damaging	Het
Col6a4	A	G	9: 106,068,198	Y906H	probably damaging	Het
Dcaf13	T	A	15: 39,143,718	I349N	probably damaging	Het
Ecd	A	G	14: 20,333,318		probably benign	Het
Enpep	C	A	3: 129,284,109	V620L	probably damaging	Het
Fbln7	A	G	2: 128,893,895	S268G	possibly damaging	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Gatd1	T	A	7: 141,409,132	T205S	probably damaging	Het
Gbe1	T	A	16: 70,528,887	V604E	probably damaging	Het
Ghsr	T	A	3: 27,374,720	I298N	probably damaging	Het
Glis1	T	C	4: 107,632,264	Y683H	probably benign	Het
Gm597	A	G	1: 28,777,802	L383P	probably benign	Het
Gpr162	T	A	6: 124,860,860	I276F	probably damaging	Het
Hps6	A	G	19: 46,004,241	T206A	probably benign	Het
Kcnk10	T	C	12: 98,496,186		probably benign	Het
Krt90	A	G	15: 101,562,716	V37A	probably benign	Het
Lmbr1	T	C	5: 29,258,747	K160E	probably damaging	Het
Nif3l1	A	G	1: 58,447,873	T73A	probably damaging	Het
Nup107	A	T	10: 117,757,294	D826E	probably damaging	Het
Nup210l	C	T	3: 90,192,940		probably benign	Het
Omd	A	G	13: 49,589,971	R166G	probably damaging	Het
Plekha4	T	C	7: 45,549,976		probably benign	Het
Ptgdr	A	G	14: 44,859,115	S47P	probably damaging	Het
Sec24c	A	G	14: 20,692,897	I940V	probably benign	Het
Shkbp1	A	G	7: 27,345,296	S457P	possibly damaging	Het
Skint1	T	C	4: 112,019,296	V138A	possibly damaging	Het
Slc38a9	A	G	13: 112,701,659		probably benign	Het
Srsf7	A	T	17: 80,205,837		probably benign	Het
Stau1	T	C	2: 166,951,315	K300R	probably damaging	Het
Stox1	A	T	10: 62,667,895	I127K	probably damaging	Het
Usp3	A	G	9: 66,530,231		probably benign	Het

Other mutations in Sympk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01114:Sympk	APN	7	19047573	missense	probably benign	0.14
IGL01834:Sympk	APN	7	19043435	missense	probably benign	0.02
IGL02588:Sympk	APN	7	19042625	missense	probably benign
IGL02601:Sympk	APN	7	19048869	missense	probably benign	0.31
IGL02645:Sympk	APN	7	19052424	missense	probably damaging	0.99
IGL02698:Sympk	APN	7	19045634	missense	probably benign	0.35
IGL02709:Sympk	APN	7	19047538	missense	probably benign	0.26
IGL02814:Sympk	APN	7	19053273	missense	probably damaging	1.00
IGL03198:Sympk	APN	7	19044996	missense	possibly damaging	0.92
butterfinger	UTSW	7	19048453	missense	probably damaging	0.98
fifth_avenue	UTSW	7	19043460	missense	possibly damaging	0.83
IGL02991:Sympk	UTSW	7	19030577	missense	probably damaging	1.00
R0391:Sympk	UTSW	7	19046849	missense	probably benign	0.06
R1872:Sympk	UTSW	7	19029145	missense	probably benign
R2058:Sympk	UTSW	7	19043529	missense	probably damaging	1.00
R2103:Sympk	UTSW	7	19054116	missense	probably benign
R2966:Sympk	UTSW	7	19030544	missense	probably damaging	1.00
R3110:Sympk	UTSW	7	19034484	missense	possibly damaging	0.69
R3112:Sympk	UTSW	7	19034484	missense	possibly damaging	0.69
R3703:Sympk	UTSW	7	19040561	missense	probably damaging	0.99
R3775:Sympk	UTSW	7	19035955	missense	probably damaging	1.00
R3930:Sympk	UTSW	7	19047522	missense	possibly damaging	0.90
R4638:Sympk	UTSW	7	19043460	missense	possibly damaging	0.83
R4639:Sympk	UTSW	7	19043460	missense	possibly damaging	0.83
R4645:Sympk	UTSW	7	19043460	missense	possibly damaging	0.83
R4688:Sympk	UTSW	7	19054410	missense	probably benign
R5050:Sympk	UTSW	7	19036042	missense	probably benign	0.19
R5051:Sympk	UTSW	7	19036042	missense	probably benign	0.19
R5052:Sympk	UTSW	7	19036042	missense	probably benign	0.19
R5092:Sympk	UTSW	7	19042659	missense	probably benign	0.17
R5211:Sympk	UTSW	7	19035889	missense	probably benign	0.22
R5591:Sympk	UTSW	7	19054039	missense	probably damaging	1.00
R5678:Sympk	UTSW	7	19049472	critical splice donor site	probably null
R5972:Sympk	UTSW	7	19046824	missense	probably benign
R6387:Sympk	UTSW	7	19052498	missense	possibly damaging	0.94
R6543:Sympk	UTSW	7	19036830	missense	probably damaging	1.00
R6984:Sympk	UTSW	7	19038043	missense	probably benign	0.00
R7141:Sympk	UTSW	7	19054092	missense	probably benign
R7292:Sympk	UTSW	7	19036030	missense	probably benign	0.01
R7319:Sympk	UTSW	7	19035845	missense	probably benign
RF064:Sympk	UTSW	7	19034395	frame shift	probably null
X0017:Sympk	UTSW	7	19040663	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- TCAGCCACAATGGAGTGACAGC -3'
(R):5'- AGCCTCTCCTTCCCTAAATGGAGC -3'

Sequencing Primer
(F):5'- GGTGGGCATGGGAGGTG -3'
(R):5'- ATTTTCACTACAGAGTGAGGCCC -3'

Posted On

2014-01-05