Incidental Mutation 'R1036:Plekha4'
ID93793
Institutional Source Beutler Lab
Gene Symbol Plekha4
Ensembl Gene ENSMUSG00000040428
Gene Namepleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
Synonyms2410005C22Rik, PEPP1
MMRRC Submission 039135-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R1036 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45526330-45554229 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 45549976 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051810] [ENSMUST00000107752] [ENSMUST00000209517] [ENSMUST00000210300] [ENSMUST00000211155] [ENSMUST00000211227] [ENSMUST00000211797]
Predicted Effect probably benign
Transcript: ENSMUST00000051810
SMART Domains Protein: ENSMUSP00000051468
Gene: ENSMUSG00000040428

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
PH 55 155 8.18e-19 SMART
low complexity region 162 190 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 321 334 N/A INTRINSIC
coiled coil region 376 419 N/A INTRINSIC
low complexity region 519 535 N/A INTRINSIC
low complexity region 608 628 N/A INTRINSIC
low complexity region 649 659 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107752
SMART Domains Protein: ENSMUSP00000103381
Gene: ENSMUSG00000030825

DomainStartEndE-ValueType
Pfam:KR 10 187 4.3e-12 PFAM
Pfam:adh_short 10 200 2.9e-53 PFAM
Pfam:Epimerase 12 184 4.2e-7 PFAM
Pfam:adh_short_C2 16 250 8.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121932
SMART Domains Protein: ENSMUSP00000113802
Gene: ENSMUSG00000040428

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
PH 55 155 8.18e-19 SMART
low complexity region 162 190 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 321 334 N/A INTRINSIC
coiled coil region 376 419 N/A INTRINSIC
low complexity region 519 535 N/A INTRINSIC
low complexity region 608 628 N/A INTRINSIC
low complexity region 649 659 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209517
Predicted Effect probably benign
Transcript: ENSMUST00000210300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210460
Predicted Effect probably benign
Transcript: ENSMUST00000210797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211106
Predicted Effect probably benign
Transcript: ENSMUST00000211155
Predicted Effect probably benign
Transcript: ENSMUST00000211227
Predicted Effect probably benign
Transcript: ENSMUST00000211348
Predicted Effect probably benign
Transcript: ENSMUST00000211797
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 86.2%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abca12 A G 1: 71,263,410 probably null Het
Abcg1 C A 17: 31,111,269 Q515K probably damaging Het
Acaa1b A T 9: 119,150,816 probably benign Het
Adamts3 T C 5: 89,696,093 probably benign Het
Aoah A C 13: 20,840,169 probably benign Het
Arhgap10 G A 8: 77,310,769 P610L probably damaging Het
Casq2 G T 3: 102,142,215 A295S probably damaging Het
Col6a4 A G 9: 106,068,198 Y906H probably damaging Het
Dcaf13 T A 15: 39,143,718 I349N probably damaging Het
Ecd A G 14: 20,333,318 probably benign Het
Enpep C A 3: 129,284,109 V620L probably damaging Het
Fbln7 A G 2: 128,893,895 S268G possibly damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Gatd1 T A 7: 141,409,132 T205S probably damaging Het
Gbe1 T A 16: 70,528,887 V604E probably damaging Het
Ghsr T A 3: 27,374,720 I298N probably damaging Het
Glis1 T C 4: 107,632,264 Y683H probably benign Het
Gm597 A G 1: 28,777,802 L383P probably benign Het
Gpr162 T A 6: 124,860,860 I276F probably damaging Het
Hps6 A G 19: 46,004,241 T206A probably benign Het
Kcnk10 T C 12: 98,496,186 probably benign Het
Krt90 A G 15: 101,562,716 V37A probably benign Het
Lmbr1 T C 5: 29,258,747 K160E probably damaging Het
Nif3l1 A G 1: 58,447,873 T73A probably damaging Het
Nup107 A T 10: 117,757,294 D826E probably damaging Het
Nup210l C T 3: 90,192,940 probably benign Het
Omd A G 13: 49,589,971 R166G probably damaging Het
Ptgdr A G 14: 44,859,115 S47P probably damaging Het
Sec24c A G 14: 20,692,897 I940V probably benign Het
Shkbp1 A G 7: 27,345,296 S457P possibly damaging Het
Skint1 T C 4: 112,019,296 V138A possibly damaging Het
Slc38a9 A G 13: 112,701,659 probably benign Het
Srsf7 A T 17: 80,205,837 probably benign Het
Stau1 T C 2: 166,951,315 K300R probably damaging Het
Stox1 A T 10: 62,667,895 I127K probably damaging Het
Sympk G A 7: 19,048,453 R832Q probably damaging Het
Usp3 A G 9: 66,530,231 probably benign Het
Other mutations in Plekha4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Plekha4 APN 7 45538235 missense probably damaging 0.97
IGL01716:Plekha4 APN 7 45534343 missense probably damaging 0.98
IGL02072:Plekha4 APN 7 45538298 missense probably benign 0.29
IGL02815:Plekha4 APN 7 45538412 missense probably damaging 1.00
IGL02939:Plekha4 APN 7 45532363 nonsense probably null
PIT4494001:Plekha4 UTSW 7 45548079 missense probably damaging 1.00
R0085:Plekha4 UTSW 7 45543949 nonsense probably null
R0239:Plekha4 UTSW 7 45532358 missense probably damaging 1.00
R0239:Plekha4 UTSW 7 45532358 missense probably damaging 1.00
R1955:Plekha4 UTSW 7 45553906 missense probably damaging 0.99
R2049:Plekha4 UTSW 7 45553798 missense probably benign 0.01
R2187:Plekha4 UTSW 7 45549274 missense probably damaging 0.99
R2888:Plekha4 UTSW 7 45538244 missense probably damaging 1.00
R5086:Plekha4 UTSW 7 45553658 missense possibly damaging 0.82
R5357:Plekha4 UTSW 7 45534771 missense probably damaging 1.00
R5604:Plekha4 UTSW 7 45549156 missense probably damaging 0.96
R5611:Plekha4 UTSW 7 45553641 missense probably benign
R6255:Plekha4 UTSW 7 45553802 utr 3 prime probably benign
R6341:Plekha4 UTSW 7 45541148 missense probably damaging 1.00
R6502:Plekha4 UTSW 7 45530576 start codon destroyed probably null 0.87
R6720:Plekha4 UTSW 7 45540886 missense possibly damaging 0.86
R6776:Plekha4 UTSW 7 45534817 missense probably damaging 1.00
R8057:Plekha4 UTSW 7 45549271 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTCATGTAGTATCCAGGGCCAG -3'
(R):5'- TGGGACGCATTTTAGAAAGGCAGC -3'

Sequencing Primer
(F):5'- CTGTAAAGTACCAGGCTGTTCAG -3'
(R):5'- gatgaagagagagcctgcc -3'
Posted On2014-01-05