Incidental Mutation 'R1036:Gatd1'
ID93794
Institutional Source Beutler Lab
Gene Symbol Gatd1
Ensembl Gene ENSMUSG00000051007
Gene Nameglutamine amidotransferase like class 1 domain containing 1
SynonymsD230016J19Rik, Pddc1
MMRRC Submission 039135-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R1036 (G1)
Quality Score173
Status Validated
Chromosome7
Chromosomal Location141407794-141414136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141409132 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 205 (T205S)
Ref Sequence ENSEMBL: ENSMUSP00000101630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106008]
Predicted Effect probably damaging
Transcript: ENSMUST00000106008
AA Change: T205S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101630
Gene: ENSMUSG00000051007
AA Change: T205S

DomainStartEndE-ValueType
PDB:1U9C|A 29 220 7e-10 PDB
SCOP:d1g2ia_ 54 206 7e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140337
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209276
Meta Mutation Damage Score 0.2342 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 86.2%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abca12 A G 1: 71,263,410 probably null Het
Abcg1 C A 17: 31,111,269 Q515K probably damaging Het
Acaa1b A T 9: 119,150,816 probably benign Het
Adamts3 T C 5: 89,696,093 probably benign Het
Aoah A C 13: 20,840,169 probably benign Het
Arhgap10 G A 8: 77,310,769 P610L probably damaging Het
Casq2 G T 3: 102,142,215 A295S probably damaging Het
Col6a4 A G 9: 106,068,198 Y906H probably damaging Het
Dcaf13 T A 15: 39,143,718 I349N probably damaging Het
Ecd A G 14: 20,333,318 probably benign Het
Enpep C A 3: 129,284,109 V620L probably damaging Het
Fbln7 A G 2: 128,893,895 S268G possibly damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Gbe1 T A 16: 70,528,887 V604E probably damaging Het
Ghsr T A 3: 27,374,720 I298N probably damaging Het
Glis1 T C 4: 107,632,264 Y683H probably benign Het
Gm597 A G 1: 28,777,802 L383P probably benign Het
Gpr162 T A 6: 124,860,860 I276F probably damaging Het
Hps6 A G 19: 46,004,241 T206A probably benign Het
Kcnk10 T C 12: 98,496,186 probably benign Het
Krt90 A G 15: 101,562,716 V37A probably benign Het
Lmbr1 T C 5: 29,258,747 K160E probably damaging Het
Nif3l1 A G 1: 58,447,873 T73A probably damaging Het
Nup107 A T 10: 117,757,294 D826E probably damaging Het
Nup210l C T 3: 90,192,940 probably benign Het
Omd A G 13: 49,589,971 R166G probably damaging Het
Plekha4 T C 7: 45,549,976 probably benign Het
Ptgdr A G 14: 44,859,115 S47P probably damaging Het
Sec24c A G 14: 20,692,897 I940V probably benign Het
Shkbp1 A G 7: 27,345,296 S457P possibly damaging Het
Skint1 T C 4: 112,019,296 V138A possibly damaging Het
Slc38a9 A G 13: 112,701,659 probably benign Het
Srsf7 A T 17: 80,205,837 probably benign Het
Stau1 T C 2: 166,951,315 K300R probably damaging Het
Stox1 A T 10: 62,667,895 I127K probably damaging Het
Sympk G A 7: 19,048,453 R832Q probably damaging Het
Usp3 A G 9: 66,530,231 probably benign Het
Other mutations in Gatd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:Gatd1 APN 7 141408960 makesense probably null
IGL02880:Gatd1 APN 7 141411038 missense possibly damaging 0.96
R1553:Gatd1 UTSW 7 141409893 missense probably benign 0.06
R2966:Gatd1 UTSW 7 141409167 missense probably damaging 1.00
R3902:Gatd1 UTSW 7 141409101 missense probably damaging 1.00
R4719:Gatd1 UTSW 7 141411068 missense probably benign 0.01
R4916:Gatd1 UTSW 7 141409097 nonsense probably null
R5013:Gatd1 UTSW 7 141408948 utr 3 prime probably benign
R7177:Gatd1 UTSW 7 141411034 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCCCATCGAGTGTCAGTACAGGAG -3'
(R):5'- ACTTGCTGTGTGTTCACAGATCCC -3'

Sequencing Primer
(F):5'- AGGACTGCATCCAAGCTTACTTC -3'
(R):5'- TTCACAGATCCCTAATGGGTG -3'
Posted On2014-01-05