Incidental Mutation 'R1036:Usp3'
ID 93797
Institutional Source Beutler Lab
Gene Symbol Usp3
Ensembl Gene ENSMUSG00000032376
Gene Name ubiquitin specific peptidase 3
Synonyms
MMRRC Submission 039135-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock # R1036 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 66514637-66593142 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 66530231 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098613] [ENSMUST00000127569] [ENSMUST00000139547] [ENSMUST00000174387]
AlphaFold Q91W36
Predicted Effect noncoding transcript
Transcript: ENSMUST00000034940
Predicted Effect probably benign
Transcript: ENSMUST00000098613
SMART Domains Protein: ENSMUSP00000096213
Gene: ENSMUSG00000032376

DomainStartEndE-ValueType
Pfam:zf-UBP 29 107 6.6e-23 PFAM
low complexity region 135 150 N/A INTRINSIC
Pfam:UCH 158 188 1.1e-8 PFAM
Pfam:UCH 178 470 4.2e-54 PFAM
Pfam:UCH_1 193 452 3.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124694
Predicted Effect probably benign
Transcript: ENSMUST00000127569
SMART Domains Protein: ENSMUSP00000122199
Gene: ENSMUSG00000032376

DomainStartEndE-ValueType
Pfam:zf-UBP 29 107 1.2e-22 PFAM
low complexity region 135 150 N/A INTRINSIC
Pfam:UCH 158 508 2.5e-61 PFAM
Pfam:UCH_1 206 490 2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154476
Predicted Effect probably benign
Transcript: ENSMUST00000174387
SMART Domains Protein: ENSMUSP00000134472
Gene: ENSMUSG00000032376

DomainStartEndE-ValueType
Pfam:zf-UBP 29 142 1.6e-7 PFAM
Pfam:UCH 114 464 9.9e-69 PFAM
Pfam:UCH_1 115 446 2e-26 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 86.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: The protein encoded by this gene is a chromatin-associated histone 2A and 2B deubiquitinating enzyme that negatively regulates the DNA damage response. Mice deficient for this enzyme have reduced hematopoietic stem cell reserves, demonstrating a requirement in hematopoietic stem cell homeostasis. In addition, knock down of protein levels results in spontaneous tumor development and shortened lifespan, consistent with a function in preserving chromosomal integrity. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abca12 A G 1: 71,263,410 probably null Het
Abcg1 C A 17: 31,111,269 Q515K probably damaging Het
Acaa1b A T 9: 119,150,816 probably benign Het
Adamts3 T C 5: 89,696,093 probably benign Het
Aoah A C 13: 20,840,169 probably benign Het
Arhgap10 G A 8: 77,310,769 P610L probably damaging Het
Casq2 G T 3: 102,142,215 A295S probably damaging Het
Col6a4 A G 9: 106,068,198 Y906H probably damaging Het
Dcaf13 T A 15: 39,143,718 I349N probably damaging Het
Ecd A G 14: 20,333,318 probably benign Het
Enpep C A 3: 129,284,109 V620L probably damaging Het
Fbln7 A G 2: 128,893,895 S268G possibly damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Gatd1 T A 7: 141,409,132 T205S probably damaging Het
Gbe1 T A 16: 70,528,887 V604E probably damaging Het
Ghsr T A 3: 27,374,720 I298N probably damaging Het
Glis1 T C 4: 107,632,264 Y683H probably benign Het
Gm597 A G 1: 28,777,802 L383P probably benign Het
Gpr162 T A 6: 124,860,860 I276F probably damaging Het
Hps6 A G 19: 46,004,241 T206A probably benign Het
Kcnk10 T C 12: 98,496,186 probably benign Het
Krt90 A G 15: 101,562,716 V37A probably benign Het
Lmbr1 T C 5: 29,258,747 K160E probably damaging Het
Nif3l1 A G 1: 58,447,873 T73A probably damaging Het
Nup107 A T 10: 117,757,294 D826E probably damaging Het
Nup210l C T 3: 90,192,940 probably benign Het
Omd A G 13: 49,589,971 R166G probably damaging Het
Plekha4 T C 7: 45,549,976 probably benign Het
Ptgdr A G 14: 44,859,115 S47P probably damaging Het
Sec24c A G 14: 20,692,897 I940V probably benign Het
Shkbp1 A G 7: 27,345,296 S457P possibly damaging Het
Skint1 T C 4: 112,019,296 V138A possibly damaging Het
Slc38a9 A G 13: 112,701,659 probably benign Het
Srsf7 A T 17: 80,205,837 probably benign Het
Stau1 T C 2: 166,951,315 K300R probably damaging Het
Stox1 A T 10: 62,667,895 I127K probably damaging Het
Sympk G A 7: 19,048,453 R832Q probably damaging Het
Other mutations in Usp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Usp3 APN 9 66562552 critical splice donor site probably null
IGL02951:Usp3 APN 9 66542550 nonsense probably null
IGL03283:Usp3 APN 9 66562549 splice site probably null
R0148:Usp3 UTSW 9 66540167 missense possibly damaging 0.80
R0152:Usp3 UTSW 9 66540150 missense probably damaging 0.97
R0184:Usp3 UTSW 9 66562581 missense probably damaging 0.99
R0628:Usp3 UTSW 9 66518444 missense probably benign 0.05
R2251:Usp3 UTSW 9 66562578 missense probably damaging 0.99
R2437:Usp3 UTSW 9 66545742 critical splice donor site probably null
R3957:Usp3 UTSW 9 66562591 missense probably benign 0.04
R4320:Usp3 UTSW 9 66530248 missense possibly damaging 0.80
R4439:Usp3 UTSW 9 66518494 missense probably benign 0.00
R4562:Usp3 UTSW 9 66520765 intron probably benign
R4659:Usp3 UTSW 9 66527070 splice site probably null
R4742:Usp3 UTSW 9 66520677 missense probably damaging 1.00
R5134:Usp3 UTSW 9 66542532 missense possibly damaging 0.82
R5242:Usp3 UTSW 9 66527150 missense probably damaging 1.00
R5556:Usp3 UTSW 9 66544021 missense possibly damaging 0.88
R6949:Usp3 UTSW 9 66520690 missense probably benign 0.37
R7440:Usp3 UTSW 9 66530255 missense probably benign 0.03
R7452:Usp3 UTSW 9 66566898 missense probably benign 0.11
R7547:Usp3 UTSW 9 66542624 missense possibly damaging 0.46
R9250:Usp3 UTSW 9 66542511 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCAGGATTTGAGGGTAAGTGCCAAC -3'
(R):5'- CTTCAAGGGGTTATCAGCAGCAGG -3'

Sequencing Primer
(F):5'- ccaagggcgagacagtaaag -3'
(R):5'- TTATCAGCAGCAGGATGCC -3'
Posted On 2014-01-05