Incidental Mutation 'R1036:Stox1'
ID93801
Institutional Source Beutler Lab
Gene Symbol Stox1
Ensembl Gene ENSMUSG00000036923
Gene Namestorkhead box 1
Synonyms4732470K04Rik
MMRRC Submission 039135-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R1036 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location62659043-62726128 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62667895 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 127 (I127K)
Ref Sequence ENSEMBL: ENSMUSP00000114652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126979] [ENSMUST00000133371] [ENSMUST00000148720]
Predicted Effect probably benign
Transcript: ENSMUST00000126979
Predicted Effect probably damaging
Transcript: ENSMUST00000133371
AA Change: I127K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114652
Gene: ENSMUSG00000036923
AA Change: I127K

DomainStartEndE-ValueType
low complexity region 31 71 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Pfam:Stork_head 108 186 4.4e-37 PFAM
low complexity region 416 429 N/A INTRINSIC
low complexity region 448 459 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000148720
AA Change: I38K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116180
Gene: ENSMUSG00000036923
AA Change: I38K

DomainStartEndE-ValueType
Pfam:Stork_head 19 98 9e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218980
Meta Mutation Damage Score 0.3814 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 86.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may function as a DNA binding protein. Mutations in this gene are associated with pre-eclampsia/eclampsia 4 (PEE4). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abca12 A G 1: 71,263,410 probably null Het
Abcg1 C A 17: 31,111,269 Q515K probably damaging Het
Acaa1b A T 9: 119,150,816 probably benign Het
Adamts3 T C 5: 89,696,093 probably benign Het
Aoah A C 13: 20,840,169 probably benign Het
Arhgap10 G A 8: 77,310,769 P610L probably damaging Het
Casq2 G T 3: 102,142,215 A295S probably damaging Het
Col6a4 A G 9: 106,068,198 Y906H probably damaging Het
Dcaf13 T A 15: 39,143,718 I349N probably damaging Het
Ecd A G 14: 20,333,318 probably benign Het
Enpep C A 3: 129,284,109 V620L probably damaging Het
Fbln7 A G 2: 128,893,895 S268G possibly damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Gatd1 T A 7: 141,409,132 T205S probably damaging Het
Gbe1 T A 16: 70,528,887 V604E probably damaging Het
Ghsr T A 3: 27,374,720 I298N probably damaging Het
Glis1 T C 4: 107,632,264 Y683H probably benign Het
Gm597 A G 1: 28,777,802 L383P probably benign Het
Gpr162 T A 6: 124,860,860 I276F probably damaging Het
Hps6 A G 19: 46,004,241 T206A probably benign Het
Kcnk10 T C 12: 98,496,186 probably benign Het
Krt90 A G 15: 101,562,716 V37A probably benign Het
Lmbr1 T C 5: 29,258,747 K160E probably damaging Het
Nif3l1 A G 1: 58,447,873 T73A probably damaging Het
Nup107 A T 10: 117,757,294 D826E probably damaging Het
Nup210l C T 3: 90,192,940 probably benign Het
Omd A G 13: 49,589,971 R166G probably damaging Het
Plekha4 T C 7: 45,549,976 probably benign Het
Ptgdr A G 14: 44,859,115 S47P probably damaging Het
Sec24c A G 14: 20,692,897 I940V probably benign Het
Shkbp1 A G 7: 27,345,296 S457P possibly damaging Het
Skint1 T C 4: 112,019,296 V138A possibly damaging Het
Slc38a9 A G 13: 112,701,659 probably benign Het
Srsf7 A T 17: 80,205,837 probably benign Het
Stau1 T C 2: 166,951,315 K300R probably damaging Het
Sympk G A 7: 19,048,453 R832Q probably damaging Het
Usp3 A G 9: 66,530,231 probably benign Het
Other mutations in Stox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Stox1 APN 10 62667913 missense probably damaging 1.00
IGL01462:Stox1 APN 10 62664682 missense probably benign 0.14
IGL01558:Stox1 APN 10 62667872 missense probably damaging 0.98
IGL02391:Stox1 APN 10 62659676 splice site probably benign
IGL02454:Stox1 APN 10 62667826 missense probably damaging 1.00
IGL02510:Stox1 APN 10 62664047 missense probably benign 0.14
IGL02635:Stox1 APN 10 62664906 missense probably benign 0.02
R1486:Stox1 UTSW 10 62664636 missense probably benign 0.06
R1751:Stox1 UTSW 10 62659666 missense probably damaging 0.97
R1763:Stox1 UTSW 10 62667965 missense probably damaging 1.00
R1892:Stox1 UTSW 10 62665399 missense possibly damaging 0.56
R2128:Stox1 UTSW 10 62664535 missense probably benign 0.42
R2406:Stox1 UTSW 10 62664166 missense probably benign 0.01
R4078:Stox1 UTSW 10 62666031 missense probably benign 0.00
R4414:Stox1 UTSW 10 62659569 missense probably benign 0.00
R4415:Stox1 UTSW 10 62659569 missense probably benign 0.00
R4416:Stox1 UTSW 10 62659569 missense probably benign 0.00
R4417:Stox1 UTSW 10 62659569 missense probably benign 0.00
R4799:Stox1 UTSW 10 62665737 missense probably damaging 1.00
R5261:Stox1 UTSW 10 62667841 missense probably damaging 0.98
R5323:Stox1 UTSW 10 62664033 missense possibly damaging 0.71
R5885:Stox1 UTSW 10 62664848 missense probably damaging 0.99
R6182:Stox1 UTSW 10 62664942 missense probably damaging 0.99
R7548:Stox1 UTSW 10 62666167 missense probably damaging 0.99
R7757:Stox1 UTSW 10 62663964 missense probably damaging 1.00
R7765:Stox1 UTSW 10 62665999 missense probably benign 0.26
R7846:Stox1 UTSW 10 62659526 missense probably damaging 1.00
R7867:Stox1 UTSW 10 62664944 missense probably benign 0.00
R7929:Stox1 UTSW 10 62659526 missense probably damaging 1.00
R7950:Stox1 UTSW 10 62664944 missense probably benign 0.00
RF014:Stox1 UTSW 10 62664246 missense probably benign 0.06
Z1176:Stox1 UTSW 10 62664018 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAGCTAAGAGCTGCAAACACTACAGA -3'
(R):5'- AGCTCACTCATCCTGAATGGTTGATGC -3'

Sequencing Primer
(F):5'- tgagccatcacacacacac -3'
(R):5'- TGGTTGATGCTAAGGCAAACTC -3'
Posted On2014-01-05