Incidental Mutation 'R1036:Nup107'
ID93803
Institutional Source Beutler Lab
Gene Symbol Nup107
Ensembl Gene ENSMUSG00000052798
Gene Namenucleoporin 107
Synonyms
MMRRC Submission 039135-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R1036 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location117750621-117792705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 117757294 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 826 (D826E)
Ref Sequence ENSEMBL: ENSMUSP00000063590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064848] [ENSMUST00000167943] [ENSMUST00000218576]
Predicted Effect probably damaging
Transcript: ENSMUST00000064848
AA Change: D826E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063590
Gene: ENSMUSG00000052798
AA Change: D826E

DomainStartEndE-ValueType
Pfam:Nup84_Nup100 210 909 2.2e-218 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167943
AA Change: D824E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129546
Gene: ENSMUSG00000052798
AA Change: D824E

DomainStartEndE-ValueType
Pfam:Nup84_Nup100 206 909 2.4e-226 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218375
Predicted Effect probably benign
Transcript: ENSMUST00000218576
Meta Mutation Damage Score 0.6478 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 86.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleoporin family. The protein is localized to the nuclear rim and is an essential component of the nuclear pore complex (NPC). All molecules entering or leaving the nucleus either diffuse through or are actively transported by the NPC. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a CRISPR-generated allele exhibit reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abca12 A G 1: 71,263,410 probably null Het
Abcg1 C A 17: 31,111,269 Q515K probably damaging Het
Acaa1b A T 9: 119,150,816 probably benign Het
Adamts3 T C 5: 89,696,093 probably benign Het
Aoah A C 13: 20,840,169 probably benign Het
Arhgap10 G A 8: 77,310,769 P610L probably damaging Het
Casq2 G T 3: 102,142,215 A295S probably damaging Het
Col6a4 A G 9: 106,068,198 Y906H probably damaging Het
Dcaf13 T A 15: 39,143,718 I349N probably damaging Het
Ecd A G 14: 20,333,318 probably benign Het
Enpep C A 3: 129,284,109 V620L probably damaging Het
Fbln7 A G 2: 128,893,895 S268G possibly damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Gatd1 T A 7: 141,409,132 T205S probably damaging Het
Gbe1 T A 16: 70,528,887 V604E probably damaging Het
Ghsr T A 3: 27,374,720 I298N probably damaging Het
Glis1 T C 4: 107,632,264 Y683H probably benign Het
Gm597 A G 1: 28,777,802 L383P probably benign Het
Gpr162 T A 6: 124,860,860 I276F probably damaging Het
Hps6 A G 19: 46,004,241 T206A probably benign Het
Kcnk10 T C 12: 98,496,186 probably benign Het
Krt90 A G 15: 101,562,716 V37A probably benign Het
Lmbr1 T C 5: 29,258,747 K160E probably damaging Het
Nif3l1 A G 1: 58,447,873 T73A probably damaging Het
Nup210l C T 3: 90,192,940 probably benign Het
Omd A G 13: 49,589,971 R166G probably damaging Het
Plekha4 T C 7: 45,549,976 probably benign Het
Ptgdr A G 14: 44,859,115 S47P probably damaging Het
Sec24c A G 14: 20,692,897 I940V probably benign Het
Shkbp1 A G 7: 27,345,296 S457P possibly damaging Het
Skint1 T C 4: 112,019,296 V138A possibly damaging Het
Slc38a9 A G 13: 112,701,659 probably benign Het
Srsf7 A T 17: 80,205,837 probably benign Het
Stau1 T C 2: 166,951,315 K300R probably damaging Het
Stox1 A T 10: 62,667,895 I127K probably damaging Het
Sympk G A 7: 19,048,453 R832Q probably damaging Het
Usp3 A G 9: 66,530,231 probably benign Het
Other mutations in Nup107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Nup107 APN 10 117763803 missense probably damaging 1.00
IGL00595:Nup107 APN 10 117773352 nonsense probably null
IGL00595:Nup107 APN 10 117773368 critical splice acceptor site probably null
IGL01120:Nup107 APN 10 117770241 splice site probably benign
IGL01420:Nup107 APN 10 117785021 missense probably damaging 1.00
IGL01646:Nup107 APN 10 117781342 missense probably damaging 1.00
IGL01748:Nup107 APN 10 117757274 missense probably benign 0.06
IGL01755:Nup107 APN 10 117774493 missense probably damaging 1.00
IGL01982:Nup107 APN 10 117759340 splice site probably benign
IGL03394:Nup107 APN 10 117782028 missense probably damaging 0.96
R0371:Nup107 UTSW 10 117763769 missense probably damaging 0.98
R1186:Nup107 UTSW 10 117777146 nonsense probably null
R1538:Nup107 UTSW 10 117790494 missense probably damaging 0.96
R1555:Nup107 UTSW 10 117751490 splice site probably benign
R1570:Nup107 UTSW 10 117763844 missense possibly damaging 0.49
R1758:Nup107 UTSW 10 117761343 missense probably damaging 1.00
R1856:Nup107 UTSW 10 117750906 missense probably damaging 1.00
R2105:Nup107 UTSW 10 117773320 missense probably damaging 1.00
R2127:Nup107 UTSW 10 117774475 missense possibly damaging 0.69
R4480:Nup107 UTSW 10 117761332 missense probably benign 0.00
R4540:Nup107 UTSW 10 117762020 splice site probably null
R4584:Nup107 UTSW 10 117766368 missense probably benign 0.05
R4878:Nup107 UTSW 10 117751418 missense probably benign 0.17
R4887:Nup107 UTSW 10 117770478 missense probably damaging 1.00
R4921:Nup107 UTSW 10 117770511 missense possibly damaging 0.95
R5960:Nup107 UTSW 10 117790010 missense probably null
R5986:Nup107 UTSW 10 117759176 missense probably damaging 1.00
R6947:Nup107 UTSW 10 117757274 missense probably benign 0.06
R7092:Nup107 UTSW 10 117790494 missense probably damaging 0.96
R7165:Nup107 UTSW 10 117773362 missense probably damaging 0.98
R7190:Nup107 UTSW 10 117762135 missense probably benign
R7331:Nup107 UTSW 10 117770198 missense probably damaging 0.99
R7405:Nup107 UTSW 10 117770415 missense probably benign 0.02
R7596:Nup107 UTSW 10 117777160 missense probably damaging 1.00
R7644:Nup107 UTSW 10 117770470 missense probably damaging 1.00
R7734:Nup107 UTSW 10 117758012 nonsense probably null
R7918:Nup107 UTSW 10 117782000 missense probably benign 0.00
R7998:Nup107 UTSW 10 117757994 missense probably damaging 1.00
R8060:Nup107 UTSW 10 117763769 missense probably damaging 0.98
R8209:Nup107 UTSW 10 117757931 missense probably benign 0.19
R8226:Nup107 UTSW 10 117757931 missense probably benign 0.19
R8470:Nup107 UTSW 10 117770469 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATACAGTGCATGGGATCTTTCTTGC -3'
(R):5'- GGCTGAGTCAGCTCATAAGAATGATGG -3'

Sequencing Primer
(F):5'- agtcctctcttctgcctctg -3'
(R):5'- CAGCTCATAAGAATGATGGTTTGTC -3'
Posted On2014-01-05