Incidental Mutation 'R1036:Aoah'
ID93810
Institutional Source Beutler Lab
Gene Symbol Aoah
Ensembl Gene ENSMUSG00000021322
Gene Nameacyloxyacyl hydrolase
Synonyms
MMRRC Submission 039135-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1036 (G1)
Quality Score202
Status Validated
Chromosome13
Chromosomal Location20794113-21036617 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 20840169 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021757] [ENSMUST00000221982]
Predicted Effect probably benign
Transcript: ENSMUST00000021757
SMART Domains Protein: ENSMUSP00000021757
Gene: ENSMUSG00000021322

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SapB 38 113 6.25e-15 SMART
Pfam:Lipase_GDSL 256 542 4.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158364
Predicted Effect probably benign
Transcript: ENSMUST00000221982
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 86.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This genes encodes an enzyme that catalyzes the hydrolysis of acyloxylacyl-linked fatty acyl chains from bacterial lipopolysaccharides. The encoded protein modulates host inflammatory response to gram-negative bacteria. The proprotein is further cleaved into a large and small chain that interact in a heterodimer. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null mice have a reduced ability to deacylate bacterial lipopolysaccharides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abca12 A G 1: 71,263,410 probably null Het
Abcg1 C A 17: 31,111,269 Q515K probably damaging Het
Acaa1b A T 9: 119,150,816 probably benign Het
Adamts3 T C 5: 89,696,093 probably benign Het
Arhgap10 G A 8: 77,310,769 P610L probably damaging Het
Casq2 G T 3: 102,142,215 A295S probably damaging Het
Col6a4 A G 9: 106,068,198 Y906H probably damaging Het
Dcaf13 T A 15: 39,143,718 I349N probably damaging Het
Ecd A G 14: 20,333,318 probably benign Het
Enpep C A 3: 129,284,109 V620L probably damaging Het
Fbln7 A G 2: 128,893,895 S268G possibly damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Gatd1 T A 7: 141,409,132 T205S probably damaging Het
Gbe1 T A 16: 70,528,887 V604E probably damaging Het
Ghsr T A 3: 27,374,720 I298N probably damaging Het
Glis1 T C 4: 107,632,264 Y683H probably benign Het
Gm597 A G 1: 28,777,802 L383P probably benign Het
Gpr162 T A 6: 124,860,860 I276F probably damaging Het
Hps6 A G 19: 46,004,241 T206A probably benign Het
Kcnk10 T C 12: 98,496,186 probably benign Het
Krt90 A G 15: 101,562,716 V37A probably benign Het
Lmbr1 T C 5: 29,258,747 K160E probably damaging Het
Nif3l1 A G 1: 58,447,873 T73A probably damaging Het
Nup107 A T 10: 117,757,294 D826E probably damaging Het
Nup210l C T 3: 90,192,940 probably benign Het
Omd A G 13: 49,589,971 R166G probably damaging Het
Plekha4 T C 7: 45,549,976 probably benign Het
Ptgdr A G 14: 44,859,115 S47P probably damaging Het
Sec24c A G 14: 20,692,897 I940V probably benign Het
Shkbp1 A G 7: 27,345,296 S457P possibly damaging Het
Skint1 T C 4: 112,019,296 V138A possibly damaging Het
Slc38a9 A G 13: 112,701,659 probably benign Het
Srsf7 A T 17: 80,205,837 probably benign Het
Stau1 T C 2: 166,951,315 K300R probably damaging Het
Stox1 A T 10: 62,667,895 I127K probably damaging Het
Sympk G A 7: 19,048,453 R832Q probably damaging Het
Usp3 A G 9: 66,530,231 probably benign Het
Other mutations in Aoah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01561:Aoah APN 13 21005094 missense probably damaging 0.97
IGL01561:Aoah APN 13 20905735 splice site probably benign
IGL01717:Aoah APN 13 20999977 missense probably damaging 0.99
IGL01997:Aoah APN 13 20999938 missense probably benign 0.00
IGL02212:Aoah APN 13 21002901 missense probably benign 0.05
IGL02325:Aoah APN 13 20917125 missense probably damaging 0.97
IGL03028:Aoah APN 13 20816582 missense possibly damaging 0.62
IGL03304:Aoah APN 13 20915010 splice site probably benign
IGL03352:Aoah APN 13 21000043 missense probably benign 0.01
H8562:Aoah UTSW 13 20816524 missense probably damaging 1.00
PIT4402001:Aoah UTSW 13 20794510 missense probably benign 0.00
R0255:Aoah UTSW 13 20979540 nonsense probably null
R0432:Aoah UTSW 13 20911198 splice site probably benign
R0501:Aoah UTSW 13 21005073 missense probably benign 0.16
R1119:Aoah UTSW 13 20914938 splice site probably benign
R1203:Aoah UTSW 13 20816594 missense probably damaging 1.00
R1589:Aoah UTSW 13 21002948 missense probably damaging 0.99
R1662:Aoah UTSW 13 21000113 intron probably null
R1907:Aoah UTSW 13 20910094 missense probably damaging 1.00
R1959:Aoah UTSW 13 20794394 start codon destroyed probably null 0.89
R2145:Aoah UTSW 13 20840096 missense probably damaging 1.00
R2237:Aoah UTSW 13 20794311 start gained probably benign
R3438:Aoah UTSW 13 20917072 missense probably benign 0.00
R4226:Aoah UTSW 13 20979526 missense possibly damaging 0.50
R4868:Aoah UTSW 13 20914981 nonsense probably null
R5026:Aoah UTSW 13 20914959 missense probably damaging 1.00
R5139:Aoah UTSW 13 21023237 missense possibly damaging 0.61
R5624:Aoah UTSW 13 20995479 missense probably damaging 1.00
R5853:Aoah UTSW 13 20999902 missense probably benign 0.01
R6134:Aoah UTSW 13 20911123 missense probably damaging 1.00
R6459:Aoah UTSW 13 20999942 missense probably damaging 0.99
R7077:Aoah UTSW 13 20910106 missense probably damaging 1.00
R7103:Aoah UTSW 13 21023315 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTCCAACCCCTGGAAGTGATG -3'
(R):5'- TTCAGAGGCACTGAGGCTAGGAAC -3'

Sequencing Primer
(F):5'- CCCCTGGAAGTGATGCTTTAATAG -3'
(R):5'- GCTAGGAACCCTGGAGGAC -3'
Posted On2014-01-05