Incidental Mutation 'R1036:Slc38a9'
ID93815
Institutional Source Beutler Lab
Gene Symbol Slc38a9
Ensembl Gene ENSMUSG00000047789
Gene Namesolute carrier family 38, member 9
Synonyms
MMRRC Submission 039135-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R1036 (G1)
Quality Score224
Status Validated
Chromosome13
Chromosomal Location112660751-112738749 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 112701659 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000052172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052514]
Predicted Effect probably benign
Transcript: ENSMUST00000052514
SMART Domains Protein: ENSMUSP00000052172
Gene: ENSMUSG00000047789

DomainStartEndE-ValueType
Pfam:Aa_trans 114 253 4.5e-17 PFAM
Pfam:Aa_trans 266 560 2.5e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224669
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 86.2%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abca12 A G 1: 71,263,410 probably null Het
Abcg1 C A 17: 31,111,269 Q515K probably damaging Het
Acaa1b A T 9: 119,150,816 probably benign Het
Adamts3 T C 5: 89,696,093 probably benign Het
Aoah A C 13: 20,840,169 probably benign Het
Arhgap10 G A 8: 77,310,769 P610L probably damaging Het
Casq2 G T 3: 102,142,215 A295S probably damaging Het
Col6a4 A G 9: 106,068,198 Y906H probably damaging Het
Dcaf13 T A 15: 39,143,718 I349N probably damaging Het
Ecd A G 14: 20,333,318 probably benign Het
Enpep C A 3: 129,284,109 V620L probably damaging Het
Fbln7 A G 2: 128,893,895 S268G possibly damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Gatd1 T A 7: 141,409,132 T205S probably damaging Het
Gbe1 T A 16: 70,528,887 V604E probably damaging Het
Ghsr T A 3: 27,374,720 I298N probably damaging Het
Glis1 T C 4: 107,632,264 Y683H probably benign Het
Gm597 A G 1: 28,777,802 L383P probably benign Het
Gpr162 T A 6: 124,860,860 I276F probably damaging Het
Hps6 A G 19: 46,004,241 T206A probably benign Het
Kcnk10 T C 12: 98,496,186 probably benign Het
Krt90 A G 15: 101,562,716 V37A probably benign Het
Lmbr1 T C 5: 29,258,747 K160E probably damaging Het
Nif3l1 A G 1: 58,447,873 T73A probably damaging Het
Nup107 A T 10: 117,757,294 D826E probably damaging Het
Nup210l C T 3: 90,192,940 probably benign Het
Omd A G 13: 49,589,971 R166G probably damaging Het
Plekha4 T C 7: 45,549,976 probably benign Het
Ptgdr A G 14: 44,859,115 S47P probably damaging Het
Sec24c A G 14: 20,692,897 I940V probably benign Het
Shkbp1 A G 7: 27,345,296 S457P possibly damaging Het
Skint1 T C 4: 112,019,296 V138A possibly damaging Het
Srsf7 A T 17: 80,205,837 probably benign Het
Stau1 T C 2: 166,951,315 K300R probably damaging Het
Stox1 A T 10: 62,667,895 I127K probably damaging Het
Sympk G A 7: 19,048,453 R832Q probably damaging Het
Usp3 A G 9: 66,530,231 probably benign Het
Other mutations in Slc38a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Slc38a9 APN 13 112701618 missense probably damaging 1.00
IGL01950:Slc38a9 APN 13 112695253 missense probably damaging 1.00
IGL01955:Slc38a9 APN 13 112695418 splice site probably benign
IGL02352:Slc38a9 APN 13 112690186 missense probably benign 0.10
IGL02359:Slc38a9 APN 13 112690186 missense probably benign 0.10
IGL02407:Slc38a9 APN 13 112690243 missense probably benign
IGL02511:Slc38a9 APN 13 112698007 missense possibly damaging 0.47
IGL02588:Slc38a9 APN 13 112697977 splice site probably null
IGL03278:Slc38a9 APN 13 112689518 splice site probably benign
R0126:Slc38a9 UTSW 13 112729257 missense possibly damaging 0.52
R0553:Slc38a9 UTSW 13 112714198 missense probably damaging 1.00
R0558:Slc38a9 UTSW 13 112729196 critical splice acceptor site probably null
R0699:Slc38a9 UTSW 13 112723289 missense probably damaging 1.00
R1142:Slc38a9 UTSW 13 112714210 missense probably damaging 1.00
R1344:Slc38a9 UTSW 13 112690180 missense probably benign 0.20
R1418:Slc38a9 UTSW 13 112690180 missense probably benign 0.20
R4223:Slc38a9 UTSW 13 112714248 critical splice donor site probably null
R4344:Slc38a9 UTSW 13 112729215 missense probably benign 0.02
R4824:Slc38a9 UTSW 13 112723298 missense probably damaging 0.98
R4872:Slc38a9 UTSW 13 112689564 missense probably damaging 1.00
R5841:Slc38a9 UTSW 13 112695322 missense possibly damaging 0.76
R5844:Slc38a9 UTSW 13 112731501 missense probably damaging 1.00
R6039:Slc38a9 UTSW 13 112669697 missense probably damaging 1.00
R6039:Slc38a9 UTSW 13 112669697 missense probably damaging 1.00
R6151:Slc38a9 UTSW 13 112689376 missense probably damaging 1.00
R6166:Slc38a9 UTSW 13 112695267 missense possibly damaging 0.96
R6175:Slc38a9 UTSW 13 112703559 nonsense probably null
R6324:Slc38a9 UTSW 13 112726100 missense probably benign 0.01
R6747:Slc38a9 UTSW 13 112690180 missense probably benign 0.20
R6920:Slc38a9 UTSW 13 112701526 missense possibly damaging 0.63
R7342:Slc38a9 UTSW 13 112669591 start gained probably benign
R7592:Slc38a9 UTSW 13 112695355 missense probably damaging 0.99
R7787:Slc38a9 UTSW 13 112689346 missense probably damaging 0.99
R7860:Slc38a9 UTSW 13 112731614 missense probably benign
R7943:Slc38a9 UTSW 13 112731614 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCACGCTCTTGCTTTCACAG -3'
(R):5'- TGGGTTTGATCCCAAAGACCACAC -3'

Sequencing Primer
(F):5'- GCTCTTGCTTTCACAGTGATATG -3'
(R):5'- AAGCAGCTCAGAACAGTAGG -3'
Posted On2014-01-05