Incidental Mutation 'R1036:Krt90'
ID93822
Institutional Source Beutler Lab
Gene Symbol Krt90
Ensembl Gene ENSMUSG00000048699
Gene Namekeratin 90
Synonyms4732456N10Rik
MMRRC Submission 039135-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1036 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101552356-101562950 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101562716 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 37 (V37A)
Ref Sequence ENSEMBL: ENSMUSP00000023714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023714] [ENSMUST00000042957]
Predicted Effect probably benign
Transcript: ENSMUST00000023714
AA Change: V37A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000023714
Gene: ENSMUSG00000048699
AA Change: V37A

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 139 3.1e-24 PFAM
Filament 142 453 1.05e-179 SMART
low complexity region 465 522 N/A INTRINSIC
low complexity region 527 535 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042957
SMART Domains Protein: ENSMUSP00000036246
Gene: ENSMUSG00000022986

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 146 1e-32 PFAM
Filament 149 462 1.68e-178 SMART
low complexity region 468 527 N/A INTRINSIC
Meta Mutation Damage Score 0.0656 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 86.2%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit partial prenatal lethality and thickened long toenails. An increased caudal vertebrae number is observed in some mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abca12 A G 1: 71,263,410 probably null Het
Abcg1 C A 17: 31,111,269 Q515K probably damaging Het
Acaa1b A T 9: 119,150,816 probably benign Het
Adamts3 T C 5: 89,696,093 probably benign Het
Aoah A C 13: 20,840,169 probably benign Het
Arhgap10 G A 8: 77,310,769 P610L probably damaging Het
Casq2 G T 3: 102,142,215 A295S probably damaging Het
Col6a4 A G 9: 106,068,198 Y906H probably damaging Het
Dcaf13 T A 15: 39,143,718 I349N probably damaging Het
Ecd A G 14: 20,333,318 probably benign Het
Enpep C A 3: 129,284,109 V620L probably damaging Het
Fbln7 A G 2: 128,893,895 S268G possibly damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Gatd1 T A 7: 141,409,132 T205S probably damaging Het
Gbe1 T A 16: 70,528,887 V604E probably damaging Het
Ghsr T A 3: 27,374,720 I298N probably damaging Het
Glis1 T C 4: 107,632,264 Y683H probably benign Het
Gm597 A G 1: 28,777,802 L383P probably benign Het
Gpr162 T A 6: 124,860,860 I276F probably damaging Het
Hps6 A G 19: 46,004,241 T206A probably benign Het
Kcnk10 T C 12: 98,496,186 probably benign Het
Lmbr1 T C 5: 29,258,747 K160E probably damaging Het
Nif3l1 A G 1: 58,447,873 T73A probably damaging Het
Nup107 A T 10: 117,757,294 D826E probably damaging Het
Nup210l C T 3: 90,192,940 probably benign Het
Omd A G 13: 49,589,971 R166G probably damaging Het
Plekha4 T C 7: 45,549,976 probably benign Het
Ptgdr A G 14: 44,859,115 S47P probably damaging Het
Sec24c A G 14: 20,692,897 I940V probably benign Het
Shkbp1 A G 7: 27,345,296 S457P possibly damaging Het
Skint1 T C 4: 112,019,296 V138A possibly damaging Het
Slc38a9 A G 13: 112,701,659 probably benign Het
Srsf7 A T 17: 80,205,837 probably benign Het
Stau1 T C 2: 166,951,315 K300R probably damaging Het
Stox1 A T 10: 62,667,895 I127K probably damaging Het
Sympk G A 7: 19,048,453 R832Q probably damaging Het
Usp3 A G 9: 66,530,231 probably benign Het
Other mutations in Krt90
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0243:Krt90 UTSW 15 101562675 missense possibly damaging 0.78
R0732:Krt90 UTSW 15 101560425 missense possibly damaging 0.60
R1616:Krt90 UTSW 15 101560591 missense possibly damaging 0.46
R1750:Krt90 UTSW 15 101553365 unclassified probably benign
R1919:Krt90 UTSW 15 101557230 missense probably damaging 1.00
R2063:Krt90 UTSW 15 101558359 missense probably benign 0.07
R2107:Krt90 UTSW 15 101562629 missense probably benign 0.06
R2155:Krt90 UTSW 15 101562611 missense probably benign 0.00
R2404:Krt90 UTSW 15 101554670 critical splice donor site probably null
R3412:Krt90 UTSW 15 101560593 missense probably damaging 1.00
R3910:Krt90 UTSW 15 101562783 missense probably damaging 1.00
R3911:Krt90 UTSW 15 101562783 missense probably damaging 1.00
R3913:Krt90 UTSW 15 101562783 missense probably damaging 1.00
R4476:Krt90 UTSW 15 101557283 missense probably damaging 1.00
R4748:Krt90 UTSW 15 101555333 missense probably damaging 1.00
R4918:Krt90 UTSW 15 101562479 missense possibly damaging 0.47
R5883:Krt90 UTSW 15 101553219 unclassified probably benign
R6416:Krt90 UTSW 15 101559244 missense probably benign 0.12
R6674:Krt90 UTSW 15 101557326 missense probably damaging 0.99
R7025:Krt90 UTSW 15 101557175 missense possibly damaging 0.81
R7514:Krt90 UTSW 15 101553170 missense unknown
Predicted Primers PCR Primer
(F):5'- CAACTCTGTATCCTATGCCGCTGAC -3'
(R):5'- CATGCCATTGGGGTGAACACAAC -3'

Sequencing Primer
(F):5'- TATGCCGCTGACACCCAG -3'
(R):5'- GAACACAACACAGTGGTCTTTG -3'
Posted On2014-01-05