Incidental Mutation 'R1036:Abcg1'
ID93825
Institutional Source Beutler Lab
Gene Symbol Abcg1
Ensembl Gene ENSMUSG00000024030
Gene NameATP binding cassette subfamily G member 1
SynonymsWhite, Abc8
MMRRC Submission 039135-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.288) question?
Stock #R1036 (G1)
Quality Score223
Status Validated
Chromosome17
Chromosomal Location31057698-31115777 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 31111269 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 515 (Q515K)
Ref Sequence ENSEMBL: ENSMUSP00000024829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024829]
Predicted Effect probably damaging
Transcript: ENSMUST00000024829
AA Change: Q515K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024829
Gene: ENSMUSG00000024030
AA Change: Q515K

DomainStartEndE-ValueType
low complexity region 28 47 N/A INTRINSIC
AAA 110 293 1.28e-14 SMART
Pfam:ABC2_membrane 391 602 1.4e-48 PFAM
transmembrane domain 636 658 N/A INTRINSIC
Meta Mutation Damage Score 0.5507 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 86.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. The human protein is involved in macrophage cholesterol efflux and may regulate cellular lipid homeostasis in other cell types. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal lipid homeostasis, increased numbers of multiple immune cell types, and abnormal response to a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abca12 A G 1: 71,263,410 probably null Het
Acaa1b A T 9: 119,150,816 probably benign Het
Adamts3 T C 5: 89,696,093 probably benign Het
Aoah A C 13: 20,840,169 probably benign Het
Arhgap10 G A 8: 77,310,769 P610L probably damaging Het
Casq2 G T 3: 102,142,215 A295S probably damaging Het
Col6a4 A G 9: 106,068,198 Y906H probably damaging Het
Dcaf13 T A 15: 39,143,718 I349N probably damaging Het
Ecd A G 14: 20,333,318 probably benign Het
Enpep C A 3: 129,284,109 V620L probably damaging Het
Fbln7 A G 2: 128,893,895 S268G possibly damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Gatd1 T A 7: 141,409,132 T205S probably damaging Het
Gbe1 T A 16: 70,528,887 V604E probably damaging Het
Ghsr T A 3: 27,374,720 I298N probably damaging Het
Glis1 T C 4: 107,632,264 Y683H probably benign Het
Gm597 A G 1: 28,777,802 L383P probably benign Het
Gpr162 T A 6: 124,860,860 I276F probably damaging Het
Hps6 A G 19: 46,004,241 T206A probably benign Het
Kcnk10 T C 12: 98,496,186 probably benign Het
Krt90 A G 15: 101,562,716 V37A probably benign Het
Lmbr1 T C 5: 29,258,747 K160E probably damaging Het
Nif3l1 A G 1: 58,447,873 T73A probably damaging Het
Nup107 A T 10: 117,757,294 D826E probably damaging Het
Nup210l C T 3: 90,192,940 probably benign Het
Omd A G 13: 49,589,971 R166G probably damaging Het
Plekha4 T C 7: 45,549,976 probably benign Het
Ptgdr A G 14: 44,859,115 S47P probably damaging Het
Sec24c A G 14: 20,692,897 I940V probably benign Het
Shkbp1 A G 7: 27,345,296 S457P possibly damaging Het
Skint1 T C 4: 112,019,296 V138A possibly damaging Het
Slc38a9 A G 13: 112,701,659 probably benign Het
Srsf7 A T 17: 80,205,837 probably benign Het
Stau1 T C 2: 166,951,315 K300R probably damaging Het
Stox1 A T 10: 62,667,895 I127K probably damaging Het
Sympk G A 7: 19,048,453 R832Q probably damaging Het
Usp3 A G 9: 66,530,231 probably benign Het
Other mutations in Abcg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01962:Abcg1 APN 17 31105540 missense probably benign 0.11
IGL02496:Abcg1 APN 17 31105604 missense probably damaging 0.98
IGL03264:Abcg1 APN 17 31064454 missense probably benign 0.10
PIT4362001:Abcg1 UTSW 17 31064424 missense possibly damaging 0.81
R0682:Abcg1 UTSW 17 31111251 missense probably benign 0.13
R1109:Abcg1 UTSW 17 31111236 missense probably benign 0.01
R1401:Abcg1 UTSW 17 31114158 missense possibly damaging 0.93
R1500:Abcg1 UTSW 17 31111279 missense probably benign 0.11
R2187:Abcg1 UTSW 17 31105517 missense probably damaging 0.99
R2504:Abcg1 UTSW 17 31092395 missense probably damaging 0.98
R3744:Abcg1 UTSW 17 31111216 splice site probably benign
R4632:Abcg1 UTSW 17 31064473 missense probably benign
R4657:Abcg1 UTSW 17 31108434 missense probably benign 0.13
R4679:Abcg1 UTSW 17 31114261 missense probably benign 0.31
R4845:Abcg1 UTSW 17 31114083 missense possibly damaging 0.94
R5061:Abcg1 UTSW 17 31092392 missense probably damaging 1.00
R5685:Abcg1 UTSW 17 31098286 nonsense probably null
R6743:Abcg1 UTSW 17 31108347 missense possibly damaging 0.92
R7084:Abcg1 UTSW 17 31106131 missense probably benign
R7521:Abcg1 UTSW 17 31064569 missense probably benign 0.15
R7716:Abcg1 UTSW 17 31109519 missense probably benign 0.05
R7866:Abcg1 UTSW 17 31098295 nonsense probably null
R7973:Abcg1 UTSW 17 31104158 missense probably damaging 0.98
R8058:Abcg1 UTSW 17 31105530 missense probably benign
R8087:Abcg1 UTSW 17 31064485 missense probably benign 0.04
Z1177:Abcg1 UTSW 17 31106166 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ACCAAGTGATTTGCCAGAGGGAAC -3'
(R):5'- GTGTAGTCACAGCCACCCTGAAAG -3'

Sequencing Primer
(F):5'- TTGCCAGAGGGAACAGACATTC -3'
(R):5'- TAAGTGTTCACTGAGCCCCATAG -3'
Posted On2014-01-05