Incidental Mutation 'R1037:Itgb6'
ID93838
Institutional Source Beutler Lab
Gene Symbol Itgb6
Ensembl Gene ENSMUSG00000026971
Gene Nameintegrin beta 6
Synonyms4831415H04Rik, 2210409C20Rik
MMRRC Submission 039136-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R1037 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location60598292-60722643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60650068 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 308 (E308G)
Ref Sequence ENSEMBL: ENSMUSP00000117815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028348] [ENSMUST00000059888] [ENSMUST00000112517] [ENSMUST00000154764]
Predicted Effect probably damaging
Transcript: ENSMUST00000028348
AA Change: E308G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028348
Gene: ENSMUSG00000026971
AA Change: E308G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PSI 22 71 2.19e-9 SMART
INB 30 454 1.84e-277 SMART
VWA 132 365 1.11e-1 SMART
internal_repeat_1 484 538 1.59e-8 PROSPERO
EGF_like 543 575 6.15e1 SMART
Integrin_B_tail 624 706 1.07e-19 SMART
Integrin_b_cyt 730 776 7.82e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000059888
AA Change: E308G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054944
Gene: ENSMUSG00000026971
AA Change: E308G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PSI 22 71 2.19e-9 SMART
INB 30 454 1.84e-277 SMART
VWA 132 365 1.11e-1 SMART
internal_repeat_1 484 538 1.59e-8 PROSPERO
EGF_like 543 575 6.15e1 SMART
Integrin_B_tail 624 706 1.07e-19 SMART
Integrin_b_cyt 730 776 7.82e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112517
AA Change: E308G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108136
Gene: ENSMUSG00000026971
AA Change: E308G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PSI 22 71 2.19e-9 SMART
INB 30 454 1.84e-277 SMART
VWA 132 365 1.11e-1 SMART
internal_repeat_1 484 538 1.81e-8 PROSPERO
EGF_like 543 575 6.15e1 SMART
Integrin_B_tail 624 706 1.07e-19 SMART
Integrin_b_cyt 730 759 2.38e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151035
Predicted Effect probably damaging
Transcript: ENSMUST00000154764
AA Change: E308G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117815
Gene: ENSMUSG00000026971
AA Change: E308G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PSI 22 71 2.19e-9 SMART
INB 30 454 1.84e-277 SMART
VWA 132 365 1.11e-1 SMART
internal_repeat_1 484 538 1.62e-8 PROSPERO
EGF_like 543 575 6.15e1 SMART
Integrin_B_tail 624 706 1.07e-19 SMART
Integrin_b_cyt 730 755 2.3e0 SMART
Meta Mutation Damage Score 0.7605 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.1%
  • 10x: 94.3%
  • 20x: 85.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the integrin superfamily. Members of this family are adhesion receptors that function in signaling from the extracellular matrix to the cell. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. The encoded protein forms a dimer with an alpha v chain and this heterodimer can bind to ligands like fibronectin and transforming growth factor beta 1. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit baldness associated with macrophage infiltration of skin, exaggerated pulmonary inflammation, and an impaired mucosal mast cell response to nematode infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,512 S139G probably benign Het
Abca2 T A 2: 25,438,228 probably benign Het
Abcb1b A T 5: 8,825,657 N610I probably benign Het
Ahnak T C 19: 9,007,618 F2089L probably benign Het
Cacnb1 T C 11: 98,005,017 probably benign Het
Cep57 T C 9: 13,818,979 I61V possibly damaging Het
Ckap5 T C 2: 91,550,629 I110T probably benign Het
Clasp2 T C 9: 113,896,634 probably benign Het
Col11a1 A C 3: 114,194,152 E265A probably damaging Het
Cst13 A G 2: 148,830,331 probably benign Het
Cyp24a1 G A 2: 170,491,617 T272M probably damaging Het
Cyp4a14 A C 4: 115,489,996 L415R probably damaging Het
Dbnl T C 11: 5,796,807 F179S probably damaging Het
Eepd1 T C 9: 25,586,783 L388P possibly damaging Het
Exosc8 G T 3: 54,732,738 A55E probably damaging Het
Fam72a G A 1: 131,533,819 V81I probably damaging Het
Fasn C T 11: 120,809,451 M2182I probably benign Het
Fras1 C T 5: 96,714,463 P2234S probably damaging Het
Grn C A 11: 102,433,070 D33E possibly damaging Het
Gsap A G 5: 21,251,165 probably benign Het
Hist1h2bn T A 13: 21,754,247 V42E probably damaging Het
Hook3 T C 8: 26,072,350 Q229R possibly damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Lrrc4c A G 2: 97,629,985 M319V probably benign Het
Mia3 T C 1: 183,357,354 I672M probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mlc1 A G 15: 88,965,461 L223P probably damaging Het
Mmp21 T C 7: 133,674,453 K554E probably benign Het
Nup160 C T 2: 90,693,902 T383I probably damaging Het
Olfr1166 A G 2: 88,124,229 I252T probably damaging Het
Olfr1197 T A 2: 88,729,032 D189V probably damaging Het
Olfr177 T C 16: 58,872,970 Y60C probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Olfr516 T A 7: 108,845,984 T9S probably benign Het
Opcml T A 9: 28,903,299 D290E probably damaging Het
Palm3 C A 8: 84,029,272 T471K probably benign Het
Prl2c5 T A 13: 13,185,907 L50* probably null Het
Pzp T C 6: 128,519,426 N281S probably benign Het
Qser1 T C 2: 104,760,555 Y1722C probably damaging Het
Ryr3 A G 2: 112,869,108 V879A probably benign Het
Sbno1 A G 5: 124,393,912 S736P possibly damaging Het
Sept5 G A 16: 18,623,094 probably benign Het
Slc17a6 A G 7: 51,649,248 probably benign Het
Spag17 A T 3: 100,103,117 T1976S probably benign Het
Swt1 A T 1: 151,370,569 probably benign Het
Tenm4 T C 7: 96,797,481 W853R probably damaging Het
Thbs1 A T 2: 118,123,051 Q983L probably damaging Het
Tmem191c A G 16: 17,276,483 probably benign Het
Tmprss11g A T 5: 86,490,747 V294D probably damaging Het
Tor1aip2 A G 1: 156,065,336 S463G probably benign Het
Trim36 A G 18: 46,196,318 probably benign Het
Ttc1 A G 11: 43,730,499 V285A possibly damaging Het
Uckl1 C T 2: 181,572,485 R303H possibly damaging Het
Vwa8 C A 14: 79,086,654 C1132* probably null Het
Other mutations in Itgb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Itgb6 APN 2 60620352 missense probably benign 0.07
IGL01363:Itgb6 APN 2 60611382 missense possibly damaging 0.89
IGL01810:Itgb6 APN 2 60627985 missense probably benign 0.19
IGL02026:Itgb6 APN 2 60628066 missense possibly damaging 0.79
IGL02347:Itgb6 APN 2 60611412 missense probably benign
R0372:Itgb6 UTSW 2 60627841 missense probably benign 0.28
R0533:Itgb6 UTSW 2 60669197 missense probably benign 0.22
R0542:Itgb6 UTSW 2 60605136 missense possibly damaging 0.53
R1191:Itgb6 UTSW 2 60653137 splice site probably null
R1775:Itgb6 UTSW 2 60672644 nonsense probably null
R1802:Itgb6 UTSW 2 60653281 missense probably benign 0.22
R1934:Itgb6 UTSW 2 60669149 missense probably benign 0.05
R2847:Itgb6 UTSW 2 60600535 missense probably damaging 1.00
R3934:Itgb6 UTSW 2 60611411 missense possibly damaging 0.89
R5603:Itgb6 UTSW 2 60620362 missense probably benign 0.03
R6255:Itgb6 UTSW 2 60605276 missense probably damaging 1.00
R6571:Itgb6 UTSW 2 60628456 missense probably damaging 1.00
R6908:Itgb6 UTSW 2 60650021 missense probably benign 0.02
R7010:Itgb6 UTSW 2 60649978 missense probably damaging 1.00
R7212:Itgb6 UTSW 2 60634654 missense probably damaging 0.99
R7259:Itgb6 UTSW 2 60650011 missense probably damaging 1.00
R7300:Itgb6 UTSW 2 60605306 missense probably benign 0.04
R7491:Itgb6 UTSW 2 60620376 missense probably damaging 1.00
R7532:Itgb6 UTSW 2 60669213 missense probably benign
X0018:Itgb6 UTSW 2 60672666 missense possibly damaging 0.88
Z1088:Itgb6 UTSW 2 60620211 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAACATTCAGTCACTGCCCTC -3'
(R):5'- GGCATACCGCCAGTCTGTTCTTAG -3'

Sequencing Primer
(F):5'- TTAATGCCAGTGGATGACCC -3'
(R):5'- TGAACTTACAAGACTTGGGACC -3'
Posted On2014-01-05