Incidental Mutation 'R1037:Qser1'
ID93844
Institutional Source Beutler Lab
Gene Symbol Qser1
Ensembl Gene ENSMUSG00000074994
Gene Nameglutamine and serine rich 1
Synonyms4732486I23Rik
MMRRC Submission 039136-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock #R1037 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location104754795-104816760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104760555 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1722 (Y1722C)
Ref Sequence ENSEMBL: ENSMUSP00000155882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117237] [ENSMUST00000231375]
Predicted Effect probably benign
Transcript: ENSMUST00000117237
AA Change: Y1632C

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000114062
Gene: ENSMUSG00000074994
AA Change: Y1632C

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
low complexity region 196 209 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
low complexity region 532 550 N/A INTRINSIC
low complexity region 697 713 N/A INTRINSIC
low complexity region 1037 1050 N/A INTRINSIC
low complexity region 1420 1449 N/A INTRINSIC
Pfam:DUF4211 1470 1616 1e-26 PFAM
low complexity region 1631 1647 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231375
AA Change: Y1722C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.1400 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.1%
  • 10x: 94.3%
  • 20x: 85.9%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,512 S139G probably benign Het
Abca2 T A 2: 25,438,228 probably benign Het
Abcb1b A T 5: 8,825,657 N610I probably benign Het
Ahnak T C 19: 9,007,618 F2089L probably benign Het
Cacnb1 T C 11: 98,005,017 probably benign Het
Cep57 T C 9: 13,818,979 I61V possibly damaging Het
Ckap5 T C 2: 91,550,629 I110T probably benign Het
Clasp2 T C 9: 113,896,634 probably benign Het
Col11a1 A C 3: 114,194,152 E265A probably damaging Het
Cst13 A G 2: 148,830,331 probably benign Het
Cyp24a1 G A 2: 170,491,617 T272M probably damaging Het
Cyp4a14 A C 4: 115,489,996 L415R probably damaging Het
Dbnl T C 11: 5,796,807 F179S probably damaging Het
Eepd1 T C 9: 25,586,783 L388P possibly damaging Het
Exosc8 G T 3: 54,732,738 A55E probably damaging Het
Fam72a G A 1: 131,533,819 V81I probably damaging Het
Fasn C T 11: 120,809,451 M2182I probably benign Het
Fras1 C T 5: 96,714,463 P2234S probably damaging Het
Grn C A 11: 102,433,070 D33E possibly damaging Het
Gsap A G 5: 21,251,165 probably benign Het
Hist1h2bn T A 13: 21,754,247 V42E probably damaging Het
Hook3 T C 8: 26,072,350 Q229R possibly damaging Het
Itgb6 T C 2: 60,650,068 E308G probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Lrrc4c A G 2: 97,629,985 M319V probably benign Het
Mia3 T C 1: 183,357,354 I672M probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mlc1 A G 15: 88,965,461 L223P probably damaging Het
Mmp21 T C 7: 133,674,453 K554E probably benign Het
Nup160 C T 2: 90,693,902 T383I probably damaging Het
Olfr1166 A G 2: 88,124,229 I252T probably damaging Het
Olfr1197 T A 2: 88,729,032 D189V probably damaging Het
Olfr177 T C 16: 58,872,970 Y60C probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Olfr516 T A 7: 108,845,984 T9S probably benign Het
Opcml T A 9: 28,903,299 D290E probably damaging Het
Palm3 C A 8: 84,029,272 T471K probably benign Het
Prl2c5 T A 13: 13,185,907 L50* probably null Het
Pzp T C 6: 128,519,426 N281S probably benign Het
Ryr3 A G 2: 112,869,108 V879A probably benign Het
Sbno1 A G 5: 124,393,912 S736P possibly damaging Het
Sept5 G A 16: 18,623,094 probably benign Het
Slc17a6 A G 7: 51,649,248 probably benign Het
Spag17 A T 3: 100,103,117 T1976S probably benign Het
Swt1 A T 1: 151,370,569 probably benign Het
Tenm4 T C 7: 96,797,481 W853R probably damaging Het
Thbs1 A T 2: 118,123,051 Q983L probably damaging Het
Tmem191c A G 16: 17,276,483 probably benign Het
Tmprss11g A T 5: 86,490,747 V294D probably damaging Het
Tor1aip2 A G 1: 156,065,336 S463G probably benign Het
Trim36 A G 18: 46,196,318 probably benign Het
Ttc1 A G 11: 43,730,499 V285A possibly damaging Het
Uckl1 C T 2: 181,572,485 R303H possibly damaging Het
Vwa8 C A 14: 79,086,654 C1132* probably null Het
Other mutations in Qser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Qser1 APN 2 104766056 missense probably damaging 1.00
IGL00402:Qser1 APN 2 104786981 missense probably benign 0.00
IGL00417:Qser1 APN 2 104786903 missense probably damaging 1.00
IGL00756:Qser1 APN 2 104787671 missense possibly damaging 0.55
IGL01304:Qser1 APN 2 104787631 missense probably damaging 0.99
IGL01317:Qser1 APN 2 104786979 missense probably damaging 0.99
IGL02186:Qser1 APN 2 104788261 missense probably damaging 1.00
IGL03236:Qser1 APN 2 104786532 missense probably benign 0.35
IGL03365:Qser1 APN 2 104786999 missense probably damaging 1.00
Behoove UTSW 2 104786977 nonsense probably null
I1329:Qser1 UTSW 2 104786977 nonsense probably null
R0270:Qser1 UTSW 2 104788961 missense probably benign 0.03
R0395:Qser1 UTSW 2 104762881 missense probably damaging 1.00
R0523:Qser1 UTSW 2 104789676 missense probably damaging 1.00
R0727:Qser1 UTSW 2 104777311 splice site probably benign
R1222:Qser1 UTSW 2 104777431 missense probably damaging 1.00
R1418:Qser1 UTSW 2 104777431 missense probably damaging 1.00
R1891:Qser1 UTSW 2 104790099 missense probably benign
R1974:Qser1 UTSW 2 104760541 missense probably damaging 1.00
R2200:Qser1 UTSW 2 104789013 missense probably damaging 1.00
R4179:Qser1 UTSW 2 104776384 missense probably benign 0.19
R4379:Qser1 UTSW 2 104766059 splice site probably null
R4418:Qser1 UTSW 2 104789421 missense probably damaging 1.00
R4585:Qser1 UTSW 2 104786793 missense probably benign 0.01
R4697:Qser1 UTSW 2 104787183 missense probably benign 0.00
R4749:Qser1 UTSW 2 104787304 missense probably benign 0.16
R4775:Qser1 UTSW 2 104789901 missense probably damaging 1.00
R5010:Qser1 UTSW 2 104787831 missense possibly damaging 0.67
R5070:Qser1 UTSW 2 104787282 missense possibly damaging 0.49
R5268:Qser1 UTSW 2 104787431 missense possibly damaging 0.47
R5384:Qser1 UTSW 2 104786642 missense probably damaging 1.00
R5400:Qser1 UTSW 2 104789874 missense probably damaging 1.00
R5502:Qser1 UTSW 2 104786574 missense probably benign 0.00
R5615:Qser1 UTSW 2 104789694 missense possibly damaging 0.78
R5664:Qser1 UTSW 2 104778196 missense probably damaging 1.00
R5750:Qser1 UTSW 2 104788923 missense probably damaging 1.00
R5793:Qser1 UTSW 2 104762860 missense probably damaging 1.00
R6035:Qser1 UTSW 2 104787123 missense probably damaging 0.99
R6035:Qser1 UTSW 2 104787123 missense probably damaging 0.99
R6171:Qser1 UTSW 2 104789283 missense probably damaging 1.00
R6223:Qser1 UTSW 2 104787648 missense probably benign 0.01
R6254:Qser1 UTSW 2 104790090 missense probably benign 0.07
R6303:Qser1 UTSW 2 104762830 missense probably damaging 1.00
R6653:Qser1 UTSW 2 104780260 missense possibly damaging 0.85
R6703:Qser1 UTSW 2 104777325 missense possibly damaging 0.50
R6970:Qser1 UTSW 2 104788130 missense probably benign 0.25
R7064:Qser1 UTSW 2 104787119 missense probably damaging 1.00
R7478:Qser1 UTSW 2 104789514 missense probably damaging 1.00
R7643:Qser1 UTSW 2 104786977 nonsense probably null
T0722:Qser1 UTSW 2 104786832 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- cagcaccCCCCAAATAACAAATACTGA -3'
(R):5'- AGCAGGCAACACGTCTATTATTTTGCTA -3'

Sequencing Primer
(F):5'- caggacaggtagtggtaaacag -3'
(R):5'- GTTTGTTTTTCAAATGGCATGTACTC -3'
Posted On2014-01-05