Incidental Mutation 'R1037:Cyp4a14'
ID 93854
Institutional Source Beutler Lab
Gene Symbol Cyp4a14
Ensembl Gene ENSMUSG00000028715
Gene Name cytochrome P450, family 4, subfamily a, polypeptide 14
Synonyms
MMRRC Submission 039136-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R1037 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 115343397-115353339 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 115347193 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 415 (L415R)
Ref Sequence ENSEMBL: ENSMUSP00000030487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030487]
AlphaFold O35728
Predicted Effect probably damaging
Transcript: ENSMUST00000030487
AA Change: L415R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030487
Gene: ENSMUSG00000028715
AA Change: L415R

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 503 5.4e-129 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124412
Meta Mutation Damage Score 0.8514 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.1%
  • 10x: 94.3%
  • 20x: 85.9%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Male mice homozygous for disruption of this gene display high blood pressure. Blood pressure is elevated in females as well to levels comparable to normotensive males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 106,436,144 (GRCm39) S139G probably benign Het
Abca2 T A 2: 25,328,240 (GRCm39) probably benign Het
Abcb1b A T 5: 8,875,657 (GRCm39) N610I probably benign Het
Ahnak T C 19: 8,984,982 (GRCm39) F2089L probably benign Het
Cacnb1 T C 11: 97,895,843 (GRCm39) probably benign Het
Cep57 T C 9: 13,730,275 (GRCm39) I61V possibly damaging Het
Ckap5 T C 2: 91,380,974 (GRCm39) I110T probably benign Het
Clasp2 T C 9: 113,725,702 (GRCm39) probably benign Het
Col11a1 A C 3: 113,987,801 (GRCm39) E265A probably damaging Het
Cst13 A G 2: 148,672,251 (GRCm39) probably benign Het
Cyp24a1 G A 2: 170,333,537 (GRCm39) T272M probably damaging Het
Dbnl T C 11: 5,746,807 (GRCm39) F179S probably damaging Het
Eepd1 T C 9: 25,498,079 (GRCm39) L388P possibly damaging Het
Exosc8 G T 3: 54,640,159 (GRCm39) A55E probably damaging Het
Fam72a G A 1: 131,461,557 (GRCm39) V81I probably damaging Het
Fasn C T 11: 120,700,277 (GRCm39) M2182I probably benign Het
Fras1 C T 5: 96,862,322 (GRCm39) P2234S probably damaging Het
Grn C A 11: 102,323,896 (GRCm39) D33E possibly damaging Het
Gsap A G 5: 21,456,163 (GRCm39) probably benign Het
H2bc15 T A 13: 21,938,417 (GRCm39) V42E probably damaging Het
Hook3 T C 8: 26,562,378 (GRCm39) Q229R possibly damaging Het
Itgb6 T C 2: 60,480,412 (GRCm39) E308G probably damaging Het
Kmo C T 1: 175,479,184 (GRCm39) P240L possibly damaging Het
Lrrc4c A G 2: 97,460,330 (GRCm39) M319V probably benign Het
Mia3 T C 1: 183,138,698 (GRCm39) I672M probably benign Het
Mib2 C T 4: 155,743,917 (GRCm39) G42S probably damaging Het
Mlc1 A G 15: 88,849,664 (GRCm39) L223P probably damaging Het
Mmp21 T C 7: 133,276,182 (GRCm39) K554E probably benign Het
Nup160 C T 2: 90,524,246 (GRCm39) T383I probably damaging Het
Opcml T A 9: 28,814,595 (GRCm39) D290E probably damaging Het
Or10a3b T A 7: 108,445,191 (GRCm39) T9S probably benign Het
Or4a27 T A 2: 88,559,376 (GRCm39) D189V probably damaging Het
Or5ac19 C T 16: 59,089,307 (GRCm39) C241Y probably damaging Het
Or5d38 A G 2: 87,954,573 (GRCm39) I252T probably damaging Het
Or5k14 T C 16: 58,693,333 (GRCm39) Y60C probably damaging Het
Palm3 C A 8: 84,755,901 (GRCm39) T471K probably benign Het
Prl2c5 T A 13: 13,360,492 (GRCm39) L50* probably null Het
Pzp T C 6: 128,496,389 (GRCm39) N281S probably benign Het
Qser1 T C 2: 104,590,900 (GRCm39) Y1722C probably damaging Het
Ryr3 A G 2: 112,699,453 (GRCm39) V879A probably benign Het
Sbno1 A G 5: 124,531,975 (GRCm39) S736P possibly damaging Het
Septin5 G A 16: 18,441,844 (GRCm39) probably benign Het
Slc17a6 A G 7: 51,298,996 (GRCm39) probably benign Het
Spag17 A T 3: 100,010,433 (GRCm39) T1976S probably benign Het
Swt1 A T 1: 151,246,320 (GRCm39) probably benign Het
Tenm4 T C 7: 96,446,688 (GRCm39) W853R probably damaging Het
Thbs1 A T 2: 117,953,532 (GRCm39) Q983L probably damaging Het
Tmem191 A G 16: 17,094,347 (GRCm39) probably benign Het
Tmprss11g A T 5: 86,638,606 (GRCm39) V294D probably damaging Het
Tor1aip2 A G 1: 155,941,082 (GRCm39) S463G probably benign Het
Trim36 A G 18: 46,329,385 (GRCm39) probably benign Het
Ttc1 A G 11: 43,621,326 (GRCm39) V285A possibly damaging Het
Uckl1 C T 2: 181,214,278 (GRCm39) R303H possibly damaging Het
Vwa8 C A 14: 79,324,094 (GRCm39) C1132* probably null Het
Other mutations in Cyp4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Cyp4a14 APN 4 115,347,149 (GRCm39) splice site probably benign
IGL01539:Cyp4a14 APN 4 115,344,374 (GRCm39) missense possibly damaging 0.71
IGL01802:Cyp4a14 APN 4 115,352,134 (GRCm39) nonsense probably null
IGL02309:Cyp4a14 APN 4 115,348,829 (GRCm39) missense probably damaging 0.99
IGL02330:Cyp4a14 APN 4 115,352,224 (GRCm39) splice site probably benign
IGL03302:Cyp4a14 APN 4 115,348,575 (GRCm39) missense probably benign 0.00
R1236:Cyp4a14 UTSW 4 115,349,367 (GRCm39) missense probably benign 0.01
R2132:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2133:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2873:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R4015:Cyp4a14 UTSW 4 115,348,331 (GRCm39) missense probably damaging 1.00
R4925:Cyp4a14 UTSW 4 115,353,133 (GRCm39) missense possibly damaging 0.68
R5104:Cyp4a14 UTSW 4 115,353,126 (GRCm39) missense probably damaging 1.00
R5135:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R5150:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R5930:Cyp4a14 UTSW 4 115,348,607 (GRCm39) missense probably damaging 1.00
R5997:Cyp4a14 UTSW 4 115,353,297 (GRCm39) nonsense probably null
R6269:Cyp4a14 UTSW 4 115,348,328 (GRCm39) missense possibly damaging 0.87
R6354:Cyp4a14 UTSW 4 115,344,441 (GRCm39) missense probably damaging 1.00
R6377:Cyp4a14 UTSW 4 115,353,280 (GRCm39) missense probably benign 0.01
R6534:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R6563:Cyp4a14 UTSW 4 115,349,283 (GRCm39) missense probably benign 0.23
R6751:Cyp4a14 UTSW 4 115,348,391 (GRCm39) missense probably damaging 0.99
R7039:Cyp4a14 UTSW 4 115,348,278 (GRCm39) missense probably benign 0.23
R7125:Cyp4a14 UTSW 4 115,348,358 (GRCm39) missense probably damaging 1.00
R7379:Cyp4a14 UTSW 4 115,350,907 (GRCm39) splice site probably null
R7544:Cyp4a14 UTSW 4 115,348,283 (GRCm39) missense probably damaging 0.98
R7591:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R7740:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R7741:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R7753:Cyp4a14 UTSW 4 115,350,861 (GRCm39) missense probably damaging 1.00
R7789:Cyp4a14 UTSW 4 115,352,107 (GRCm39) missense probably benign 0.00
R8064:Cyp4a14 UTSW 4 115,352,155 (GRCm39) missense probably benign
R8311:Cyp4a14 UTSW 4 115,348,275 (GRCm39) missense probably damaging 1.00
R8458:Cyp4a14 UTSW 4 115,353,129 (GRCm39) missense probably damaging 1.00
R8868:Cyp4a14 UTSW 4 115,348,553 (GRCm39) missense probably damaging 1.00
R9039:Cyp4a14 UTSW 4 115,344,461 (GRCm39) missense probably damaging 0.97
R9632:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
R9710:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
Z1176:Cyp4a14 UTSW 4 115,347,214 (GRCm39) missense probably benign 0.01
Z1177:Cyp4a14 UTSW 4 115,348,650 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CCTGAGAATGGCAGATAAGCATGGC -3'
(R):5'- TGGAGGGGAATTGCATCTTGTTACC -3'

Sequencing Primer
(F):5'- CTATGGTGAGAAGAATCTGGTGC -3'
(R):5'- GTCATTGCACTTACTAGAAGCAGG -3'
Posted On 2014-01-05