Incidental Mutation 'R1037:Mmp21'
ID93867
Institutional Source Beutler Lab
Gene Symbol Mmp21
Ensembl Gene ENSMUSG00000030981
Gene Namematrix metallopeptidase 21
Synonyms
MMRRC Submission 039136-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R1037 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location133674270-133680061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133674453 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 554 (K554E)
Ref Sequence ENSEMBL: ENSMUSP00000033278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033278] [ENSMUST00000051169] [ENSMUST00000122136] [ENSMUST00000128901]
Predicted Effect probably benign
Transcript: ENSMUST00000033278
AA Change: K554E

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000033278
Gene: ENSMUSG00000030981
AA Change: K554E

DomainStartEndE-ValueType
Pfam:PG_binding_1 46 107 5.6e-13 PFAM
low complexity region 117 133 N/A INTRINSIC
ZnMc 166 327 2.67e-32 SMART
HX 332 390 1.97e-1 SMART
HX 393 448 5.36e-6 SMART
HX 450 497 9.33e-6 SMART
HX 505 548 1.11e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051169
SMART Domains Protein: ENSMUSP00000059166
Gene: ENSMUSG00000039990

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
low complexity region 1171 1184 N/A INTRINSIC
low complexity region 1229 1237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122136
SMART Domains Protein: ENSMUSP00000113853
Gene: ENSMUSG00000030981

DomainStartEndE-ValueType
Pfam:PG_binding_1 46 107 1.9e-13 PFAM
low complexity region 117 133 N/A INTRINSIC
ZnMc 166 327 2.67e-32 SMART
Pfam:Hemopexin 351 390 4.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128901
SMART Domains Protein: ENSMUSP00000115641
Gene: ENSMUSG00000039990

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 433 443 N/A INTRINSIC
low complexity region 495 515 N/A INTRINSIC
low complexity region 1137 1150 N/A INTRINSIC
low complexity region 1195 1203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137338
Predicted Effect probably benign
Transcript: ENSMUST00000176661
SMART Domains Protein: ENSMUSP00000134967
Gene: ENSMUSG00000039990

DomainStartEndE-ValueType
low complexity region 116 124 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211072
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.1%
  • 10x: 94.3%
  • 20x: 85.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. Mice harboring certain mutations in this gene exhibit congenital heart defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit heterotaxia and congenital cardiovascular defects including d-loop transposition of the great arteries, tricupid valve atresia, and ventricular septal defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,512 S139G probably benign Het
Abca2 T A 2: 25,438,228 probably benign Het
Abcb1b A T 5: 8,825,657 N610I probably benign Het
Ahnak T C 19: 9,007,618 F2089L probably benign Het
Cacnb1 T C 11: 98,005,017 probably benign Het
Cep57 T C 9: 13,818,979 I61V possibly damaging Het
Ckap5 T C 2: 91,550,629 I110T probably benign Het
Clasp2 T C 9: 113,896,634 probably benign Het
Col11a1 A C 3: 114,194,152 E265A probably damaging Het
Cst13 A G 2: 148,830,331 probably benign Het
Cyp24a1 G A 2: 170,491,617 T272M probably damaging Het
Cyp4a14 A C 4: 115,489,996 L415R probably damaging Het
Dbnl T C 11: 5,796,807 F179S probably damaging Het
Eepd1 T C 9: 25,586,783 L388P possibly damaging Het
Exosc8 G T 3: 54,732,738 A55E probably damaging Het
Fam72a G A 1: 131,533,819 V81I probably damaging Het
Fasn C T 11: 120,809,451 M2182I probably benign Het
Fras1 C T 5: 96,714,463 P2234S probably damaging Het
Grn C A 11: 102,433,070 D33E possibly damaging Het
Gsap A G 5: 21,251,165 probably benign Het
Hist1h2bn T A 13: 21,754,247 V42E probably damaging Het
Hook3 T C 8: 26,072,350 Q229R possibly damaging Het
Itgb6 T C 2: 60,650,068 E308G probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Lrrc4c A G 2: 97,629,985 M319V probably benign Het
Mia3 T C 1: 183,357,354 I672M probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mlc1 A G 15: 88,965,461 L223P probably damaging Het
Nup160 C T 2: 90,693,902 T383I probably damaging Het
Olfr1166 A G 2: 88,124,229 I252T probably damaging Het
Olfr1197 T A 2: 88,729,032 D189V probably damaging Het
Olfr177 T C 16: 58,872,970 Y60C probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Olfr516 T A 7: 108,845,984 T9S probably benign Het
Opcml T A 9: 28,903,299 D290E probably damaging Het
Palm3 C A 8: 84,029,272 T471K probably benign Het
Prl2c5 T A 13: 13,185,907 L50* probably null Het
Pzp T C 6: 128,519,426 N281S probably benign Het
Qser1 T C 2: 104,760,555 Y1722C probably damaging Het
Ryr3 A G 2: 112,869,108 V879A probably benign Het
Sbno1 A G 5: 124,393,912 S736P possibly damaging Het
Sept5 G A 16: 18,623,094 probably benign Het
Slc17a6 A G 7: 51,649,248 probably benign Het
Spag17 A T 3: 100,103,117 T1976S probably benign Het
Swt1 A T 1: 151,370,569 probably benign Het
Tenm4 T C 7: 96,797,481 W853R probably damaging Het
Thbs1 A T 2: 118,123,051 Q983L probably damaging Het
Tmem191c A G 16: 17,276,483 probably benign Het
Tmprss11g A T 5: 86,490,747 V294D probably damaging Het
Tor1aip2 A G 1: 156,065,336 S463G probably benign Het
Trim36 A G 18: 46,196,318 probably benign Het
Ttc1 A G 11: 43,730,499 V285A possibly damaging Het
Uckl1 C T 2: 181,572,485 R303H possibly damaging Het
Vwa8 C A 14: 79,086,654 C1132* probably null Het
Other mutations in Mmp21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Mmp21 APN 7 133675914 missense probably damaging 1.00
IGL02822:Mmp21 APN 7 133676099 missense possibly damaging 0.80
IGL03240:Mmp21 APN 7 133674571 missense probably damaging 0.97
IGL03261:Mmp21 APN 7 133674674 missense probably benign 0.01
R0659:Mmp21 UTSW 7 133677667 splice site probably benign
R1463:Mmp21 UTSW 7 133675859 splice site probably null
R1523:Mmp21 UTSW 7 133679045 missense probably benign
R1710:Mmp21 UTSW 7 133677285 missense probably damaging 1.00
R1804:Mmp21 UTSW 7 133678882 missense probably benign 0.01
R1848:Mmp21 UTSW 7 133677153 missense probably benign 0.05
R2993:Mmp21 UTSW 7 133678986 missense probably damaging 1.00
R3431:Mmp21 UTSW 7 133678750 missense probably benign 0.00
R4790:Mmp21 UTSW 7 133675030 missense probably damaging 1.00
R4870:Mmp21 UTSW 7 133678677 missense probably damaging 1.00
R5134:Mmp21 UTSW 7 133679013 missense probably benign 0.00
R5347:Mmp21 UTSW 7 133675922 missense probably benign
R5682:Mmp21 UTSW 7 133674629 missense probably benign 0.00
R5905:Mmp21 UTSW 7 133678714 missense probably benign 0.17
R6028:Mmp21 UTSW 7 133678714 missense probably benign 0.17
R6936:Mmp21 UTSW 7 133678975 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTGCCCTTTCCTAGACCAGAACTC -3'
(R):5'- GCCAAGTGTTTCCAGCAATAATGCC -3'

Sequencing Primer
(F):5'- AGTTTCAGTGCTCTAAGAGCC -3'
(R):5'- TTTCCAGCAATAATGCCTCAAAAC -3'
Posted On2014-01-05