Incidental Mutation 'R1037:Cep57'
ID93871
Institutional Source Beutler Lab
Gene Symbol Cep57
Ensembl Gene ENSMUSG00000031922
Gene Namecentrosomal protein 57
Synonyms4931428M20Rik, Tsp57, 3110002L15Rik, 4921510P06Rik
MMRRC Submission 039136-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R1037 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location13807792-13827107 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13818979 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 61 (I61V)
Ref Sequence ENSEMBL: ENSMUSP00000114665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034398] [ENSMUST00000124883] [ENSMUST00000134746] [ENSMUST00000142494] [ENSMUST00000144484] [ENSMUST00000147115] [ENSMUST00000148086] [ENSMUST00000150893]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034398
AA Change: I88V

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034398
Gene: ENSMUSG00000031922
AA Change: I88V

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Cep57_CLD 68 245 9.8e-67 PFAM
low complexity region 259 271 N/A INTRINSIC
Pfam:Cep57_MT_bd 348 420 2.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124524
Predicted Effect probably benign
Transcript: ENSMUST00000124883
SMART Domains Protein: ENSMUSP00000119081
Gene: ENSMUSG00000031922

DomainStartEndE-ValueType
Pfam:Cep57_CLD 1 96 4.7e-34 PFAM
low complexity region 110 122 N/A INTRINSIC
Pfam:Cep57_MT_bd 196 271 4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134746
AA Change: I88V

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116713
Gene: ENSMUSG00000031922
AA Change: I88V

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Cep57_CLD 68 209 1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142494
AA Change: I88V

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000114749
Gene: ENSMUSG00000031922
AA Change: I88V

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Cep57_CLD 68 245 3.3e-72 PFAM
low complexity region 259 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144484
SMART Domains Protein: ENSMUSP00000114940
Gene: ENSMUSG00000031922

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000147115
AA Change: I88V

PolyPhen 2 Score 0.489 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116931
Gene: ENSMUSG00000031922
AA Change: I88V

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Cep57_CLD 68 245 2.1e-72 PFAM
low complexity region 254 275 N/A INTRINSIC
Pfam:Cep57_MT_bd 319 394 1.3e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000148086
AA Change: I61V

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114665
Gene: ENSMUSG00000031922
AA Change: I61V

DomainStartEndE-ValueType
Pfam:Cep57_CLD 41 218 1e-71 PFAM
low complexity region 232 244 N/A INTRINSIC
Pfam:Cep57_MT_bd 318 393 6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148904
Predicted Effect probably benign
Transcript: ENSMUST00000150893
SMART Domains Protein: ENSMUSP00000115338
Gene: ENSMUSG00000031922

DomainStartEndE-ValueType
Pfam:Cep57_CLD 1 96 5.2e-37 PFAM
low complexity region 110 122 N/A INTRINSIC
Pfam:Cep57_MT_bd 196 271 2.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151878
SMART Domains Protein: ENSMUSP00000116847
Gene: ENSMUSG00000031922

DomainStartEndE-ValueType
Pfam:Cep57_CLD 1 133 1.6e-43 PFAM
low complexity region 147 159 N/A INTRINSIC
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.1%
  • 10x: 94.3%
  • 20x: 85.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein called Translokin. This protein localizes to the centrosome and has a function in microtubular stabilization. The N-terminal half of this protein is required for its centrosome localization and for its multimerization, and the C-terminal half is required for nucleating, bundling and anchoring microtubules to the centrosomes. This protein specifically interacts with fibroblast growth factor 2 (FGF2), sorting nexin 6, Ran-binding protein M and the kinesins KIF3A and KIF3B, and thus mediates the nuclear translocation and mitogenic activity of the FGF2. It also interacts with cyclin D1 and controls nucleocytoplasmic distribution of the cyclin D1 in quiescent cells. This protein is crucial for maintaining correct chromosomal number during cell division. Mutations in this gene cause mosaic variegated aneuploidy syndrome, a rare autosomal recessive disorder. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,512 S139G probably benign Het
Abca2 T A 2: 25,438,228 probably benign Het
Abcb1b A T 5: 8,825,657 N610I probably benign Het
Ahnak T C 19: 9,007,618 F2089L probably benign Het
Cacnb1 T C 11: 98,005,017 probably benign Het
Ckap5 T C 2: 91,550,629 I110T probably benign Het
Clasp2 T C 9: 113,896,634 probably benign Het
Col11a1 A C 3: 114,194,152 E265A probably damaging Het
Cst13 A G 2: 148,830,331 probably benign Het
Cyp24a1 G A 2: 170,491,617 T272M probably damaging Het
Cyp4a14 A C 4: 115,489,996 L415R probably damaging Het
Dbnl T C 11: 5,796,807 F179S probably damaging Het
Eepd1 T C 9: 25,586,783 L388P possibly damaging Het
Exosc8 G T 3: 54,732,738 A55E probably damaging Het
Fam72a G A 1: 131,533,819 V81I probably damaging Het
Fasn C T 11: 120,809,451 M2182I probably benign Het
Fras1 C T 5: 96,714,463 P2234S probably damaging Het
Grn C A 11: 102,433,070 D33E possibly damaging Het
Gsap A G 5: 21,251,165 probably benign Het
Hist1h2bn T A 13: 21,754,247 V42E probably damaging Het
Hook3 T C 8: 26,072,350 Q229R possibly damaging Het
Itgb6 T C 2: 60,650,068 E308G probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Lrrc4c A G 2: 97,629,985 M319V probably benign Het
Mia3 T C 1: 183,357,354 I672M probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mlc1 A G 15: 88,965,461 L223P probably damaging Het
Mmp21 T C 7: 133,674,453 K554E probably benign Het
Nup160 C T 2: 90,693,902 T383I probably damaging Het
Olfr1166 A G 2: 88,124,229 I252T probably damaging Het
Olfr1197 T A 2: 88,729,032 D189V probably damaging Het
Olfr177 T C 16: 58,872,970 Y60C probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Olfr516 T A 7: 108,845,984 T9S probably benign Het
Opcml T A 9: 28,903,299 D290E probably damaging Het
Palm3 C A 8: 84,029,272 T471K probably benign Het
Prl2c5 T A 13: 13,185,907 L50* probably null Het
Pzp T C 6: 128,519,426 N281S probably benign Het
Qser1 T C 2: 104,760,555 Y1722C probably damaging Het
Ryr3 A G 2: 112,869,108 V879A probably benign Het
Sbno1 A G 5: 124,393,912 S736P possibly damaging Het
Sept5 G A 16: 18,623,094 probably benign Het
Slc17a6 A G 7: 51,649,248 probably benign Het
Spag17 A T 3: 100,103,117 T1976S probably benign Het
Swt1 A T 1: 151,370,569 probably benign Het
Tenm4 T C 7: 96,797,481 W853R probably damaging Het
Thbs1 A T 2: 118,123,051 Q983L probably damaging Het
Tmem191c A G 16: 17,276,483 probably benign Het
Tmprss11g A T 5: 86,490,747 V294D probably damaging Het
Tor1aip2 A G 1: 156,065,336 S463G probably benign Het
Trim36 A G 18: 46,196,318 probably benign Het
Ttc1 A G 11: 43,730,499 V285A possibly damaging Het
Uckl1 C T 2: 181,572,485 R303H possibly damaging Het
Vwa8 C A 14: 79,086,654 C1132* probably null Het
Other mutations in Cep57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Cep57 APN 9 13819016 missense probably damaging 1.00
IGL01712:Cep57 APN 9 13813417 missense possibly damaging 0.72
IGL01965:Cep57 APN 9 13821520 unclassified probably benign
IGL02250:Cep57 APN 9 13810643 missense probably damaging 1.00
IGL02378:Cep57 APN 9 13821546 nonsense probably null
IGL02943:Cep57 APN 9 13818853 splice site probably benign
IGL03244:Cep57 APN 9 13818387 nonsense probably null
R0082:Cep57 UTSW 9 13810876 unclassified probably benign
R0330:Cep57 UTSW 9 13816985 missense probably damaging 1.00
R0786:Cep57 UTSW 9 13809870 missense probably damaging 0.99
R0962:Cep57 UTSW 9 13808743 missense possibly damaging 0.48
R1472:Cep57 UTSW 9 13821554 missense probably benign 0.03
R1773:Cep57 UTSW 9 13816068 missense probably damaging 1.00
R1776:Cep57 UTSW 9 13818874 missense probably damaging 0.99
R4162:Cep57 UTSW 9 13812633 splice site probably null
R4895:Cep57 UTSW 9 13816153 intron probably benign
R4942:Cep57 UTSW 9 13813427 missense probably damaging 0.96
R5310:Cep57 UTSW 9 13818868 missense probably damaging 1.00
R5566:Cep57 UTSW 9 13821575 missense probably damaging 0.99
R5996:Cep57 UTSW 9 13809879 missense probably damaging 0.99
R6058:Cep57 UTSW 9 13810761 missense possibly damaging 0.75
R7065:Cep57 UTSW 9 13818381 missense probably damaging 1.00
R7410:Cep57 UTSW 9 13818684 intron probably benign
R7421:Cep57 UTSW 9 13810673 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- CTTGCGTCAAATATGCCACACACTG -3'
(R):5'- AGTGCTCTGCTGCTTGGCTTAC -3'

Sequencing Primer
(F):5'- GATGTAATTCCTTACCAGTGACCAC -3'
(R):5'- cctctagcccagcgtttc -3'
Posted On2014-01-05