Incidental Mutation 'R1037:Clasp2'
ID93875
Institutional Source Beutler Lab
Gene Symbol Clasp2
Ensembl Gene ENSMUSG00000033392
Gene NameCLIP associating protein 2
Synonyms1500004F14Rik, CLASP2gamma, CLASP2beta, CLASP2alpha, CLASP2, 8030404L10Rik
MMRRC Submission 039136-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1037 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location113741473-113919682 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 113896634 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111838] [ENSMUST00000163895] [ENSMUST00000166734] [ENSMUST00000213663] [ENSMUST00000214522] [ENSMUST00000215022]
Predicted Effect probably benign
Transcript: ENSMUST00000111838
SMART Domains Protein: ENSMUSP00000107469
Gene: ENSMUSG00000033392

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 562 572 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
TOG 640 877 2.03e-1 SMART
low complexity region 995 1009 N/A INTRINSIC
TOG 1043 1274 1.49e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163895
SMART Domains Protein: ENSMUSP00000128460
Gene: ENSMUSG00000033392

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 583 593 N/A INTRINSIC
low complexity region 635 655 N/A INTRINSIC
TOG 661 898 2.03e-1 SMART
low complexity region 1016 1030 N/A INTRINSIC
TOG 1064 1295 1.49e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166734
SMART Domains Protein: ENSMUSP00000130201
Gene: ENSMUSG00000033392

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 562 572 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
TOG 640 878 7.51e-1 SMART
low complexity region 996 1010 N/A INTRINSIC
TOG 1044 1275 1.49e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213663
Predicted Effect probably benign
Transcript: ENSMUST00000214522
Predicted Effect probably benign
Transcript: ENSMUST00000215022
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.1%
  • 10x: 94.3%
  • 20x: 85.9%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Targeted deletion of this gene leads to impaired formation of stable microtubules in a wound healing assay, and results in a 2-fold reduction of directionally persistent migration in mutant embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,512 S139G probably benign Het
Abca2 T A 2: 25,438,228 probably benign Het
Abcb1b A T 5: 8,825,657 N610I probably benign Het
Ahnak T C 19: 9,007,618 F2089L probably benign Het
Cacnb1 T C 11: 98,005,017 probably benign Het
Cep57 T C 9: 13,818,979 I61V possibly damaging Het
Ckap5 T C 2: 91,550,629 I110T probably benign Het
Col11a1 A C 3: 114,194,152 E265A probably damaging Het
Cst13 A G 2: 148,830,331 probably benign Het
Cyp24a1 G A 2: 170,491,617 T272M probably damaging Het
Cyp4a14 A C 4: 115,489,996 L415R probably damaging Het
Dbnl T C 11: 5,796,807 F179S probably damaging Het
Eepd1 T C 9: 25,586,783 L388P possibly damaging Het
Exosc8 G T 3: 54,732,738 A55E probably damaging Het
Fam72a G A 1: 131,533,819 V81I probably damaging Het
Fasn C T 11: 120,809,451 M2182I probably benign Het
Fras1 C T 5: 96,714,463 P2234S probably damaging Het
Grn C A 11: 102,433,070 D33E possibly damaging Het
Gsap A G 5: 21,251,165 probably benign Het
Hist1h2bn T A 13: 21,754,247 V42E probably damaging Het
Hook3 T C 8: 26,072,350 Q229R possibly damaging Het
Itgb6 T C 2: 60,650,068 E308G probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Lrrc4c A G 2: 97,629,985 M319V probably benign Het
Mia3 T C 1: 183,357,354 I672M probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mlc1 A G 15: 88,965,461 L223P probably damaging Het
Mmp21 T C 7: 133,674,453 K554E probably benign Het
Nup160 C T 2: 90,693,902 T383I probably damaging Het
Olfr1166 A G 2: 88,124,229 I252T probably damaging Het
Olfr1197 T A 2: 88,729,032 D189V probably damaging Het
Olfr177 T C 16: 58,872,970 Y60C probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Olfr516 T A 7: 108,845,984 T9S probably benign Het
Opcml T A 9: 28,903,299 D290E probably damaging Het
Palm3 C A 8: 84,029,272 T471K probably benign Het
Prl2c5 T A 13: 13,185,907 L50* probably null Het
Pzp T C 6: 128,519,426 N281S probably benign Het
Qser1 T C 2: 104,760,555 Y1722C probably damaging Het
Ryr3 A G 2: 112,869,108 V879A probably benign Het
Sbno1 A G 5: 124,393,912 S736P possibly damaging Het
Sept5 G A 16: 18,623,094 probably benign Het
Slc17a6 A G 7: 51,649,248 probably benign Het
Spag17 A T 3: 100,103,117 T1976S probably benign Het
Swt1 A T 1: 151,370,569 probably benign Het
Tenm4 T C 7: 96,797,481 W853R probably damaging Het
Thbs1 A T 2: 118,123,051 Q983L probably damaging Het
Tmem191c A G 16: 17,276,483 probably benign Het
Tmprss11g A T 5: 86,490,747 V294D probably damaging Het
Tor1aip2 A G 1: 156,065,336 S463G probably benign Het
Trim36 A G 18: 46,196,318 probably benign Het
Ttc1 A G 11: 43,730,499 V285A possibly damaging Het
Uckl1 C T 2: 181,572,485 R303H possibly damaging Het
Vwa8 C A 14: 79,086,654 C1132* probably null Het
Other mutations in Clasp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Clasp2 APN 9 113905992 splice site probably benign
IGL00885:Clasp2 APN 9 113911416 missense probably damaging 1.00
IGL01314:Clasp2 APN 9 113906127 missense possibly damaging 0.89
IGL01344:Clasp2 APN 9 113813292 splice site probably null
IGL01567:Clasp2 APN 9 113880096 missense probably damaging 1.00
IGL02238:Clasp2 APN 9 113880020 missense probably damaging 1.00
IGL02299:Clasp2 APN 9 113879989 missense probably damaging 1.00
IGL02323:Clasp2 APN 9 113868726 splice site probably benign
IGL02635:Clasp2 APN 9 113908842 missense probably damaging 0.98
IGL02645:Clasp2 APN 9 113890061 missense probably damaging 1.00
IGL02976:Clasp2 APN 9 113906136 missense probably damaging 1.00
IGL03190:Clasp2 APN 9 113844140 nonsense probably null
IGL03219:Clasp2 APN 9 113848477 splice site probably benign
PIT4810001:Clasp2 UTSW 9 113906067 missense probably damaging 1.00
R0067:Clasp2 UTSW 9 113860141 splice site probably benign
R0067:Clasp2 UTSW 9 113860141 splice site probably benign
R0421:Clasp2 UTSW 9 113854302 missense probably benign 0.02
R0432:Clasp2 UTSW 9 113909419 missense probably benign 0.00
R0458:Clasp2 UTSW 9 113906224 intron probably null
R0865:Clasp2 UTSW 9 113911500 missense possibly damaging 0.57
R0972:Clasp2 UTSW 9 113847705 missense possibly damaging 0.58
R1925:Clasp2 UTSW 9 113906197 missense possibly damaging 0.88
R2015:Clasp2 UTSW 9 113911500 missense possibly damaging 0.57
R2066:Clasp2 UTSW 9 113906157 missense possibly damaging 0.86
R2330:Clasp2 UTSW 9 113876304 missense probably damaging 1.00
R2568:Clasp2 UTSW 9 113878764 missense probably benign
R3011:Clasp2 UTSW 9 113901513 missense probably damaging 1.00
R3879:Clasp2 UTSW 9 113889961 missense probably damaging 0.98
R3915:Clasp2 UTSW 9 113908737 missense probably damaging 0.99
R3928:Clasp2 UTSW 9 113906105 missense probably benign 0.28
R4323:Clasp2 UTSW 9 113889959 missense possibly damaging 0.91
R4571:Clasp2 UTSW 9 113847721 missense probably damaging 1.00
R4975:Clasp2 UTSW 9 113903916 missense probably damaging 1.00
R5445:Clasp2 UTSW 9 113903946 missense probably damaging 1.00
R5564:Clasp2 UTSW 9 113812768 critical splice donor site probably null
R5697:Clasp2 UTSW 9 113860122 missense probably benign 0.01
R5780:Clasp2 UTSW 9 113850152 missense probably damaging 0.99
R5787:Clasp2 UTSW 9 113862242 missense probably damaging 1.00
R6011:Clasp2 UTSW 9 113876247 missense probably benign 0.07
R6026:Clasp2 UTSW 9 113911578 missense probably benign 0.13
R6090:Clasp2 UTSW 9 113852735 missense probably benign 0.06
R6262:Clasp2 UTSW 9 113876352 critical splice donor site probably null
R6427:Clasp2 UTSW 9 113892444 missense probably damaging 1.00
R6464:Clasp2 UTSW 9 113773717 missense probably damaging 1.00
R6586:Clasp2 UTSW 9 113813264 missense probably damaging 1.00
R6628:Clasp2 UTSW 9 113896720 missense probably damaging 1.00
R6745:Clasp2 UTSW 9 113875270 nonsense probably null
R7032:Clasp2 UTSW 9 113854323 missense probably benign 0.04
R7165:Clasp2 UTSW 9 113786399 intron probably null
R7221:Clasp2 UTSW 9 113852757 missense probably damaging 0.99
R7336:Clasp2 UTSW 9 113876353 splice site probably null
R7583:Clasp2 UTSW 9 113908687 missense probably benign 0.02
X0022:Clasp2 UTSW 9 113852672 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACACTGTGACAGGAAGCTCAAGG -3'
(R):5'- AGTTAGCAAATCACTGGGCACAGG -3'

Sequencing Primer
(F):5'- GCTTGCTCATACTCTGGAAATG -3'
(R):5'- CGTCCTCAGTGGTGTCAATAAAC -3'
Posted On2014-01-05