Incidental Mutation 'R1037:Trim36'
Institutional Source Beutler Lab
Gene Symbol Trim36
Ensembl Gene ENSMUSG00000033949
Gene Nametripartite motif-containing 36
SynonymsHaprin, D18Wsu100e
MMRRC Submission 039136-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R1037 (G1)
Quality Score225
Status Validated
Chromosomal Location46165302-46212607 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 46196318 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037011] [ENSMUST00000167364]
Predicted Effect probably benign
Transcript: ENSMUST00000037011
SMART Domains Protein: ENSMUSP00000037978
Gene: ENSMUSG00000033949

RING 33 118 1.25e-5 SMART
BBOX 207 249 1.82e-7 SMART
Blast:BBC 256 381 5e-11 BLAST
FN3 418 498 1.32e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167364
SMART Domains Protein: ENSMUSP00000129771
Gene: ENSMUSG00000033949

RING 21 106 1.25e-5 SMART
BBOX 195 237 1.82e-7 SMART
Blast:BBC 244 369 4e-11 BLAST
FN3 406 486 1.32e-1 SMART
Pfam:SPRY 560 704 1.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195587
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.1%
  • 10x: 94.3%
  • 20x: 85.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,512 S139G probably benign Het
Abca2 T A 2: 25,438,228 probably benign Het
Abcb1b A T 5: 8,825,657 N610I probably benign Het
Ahnak T C 19: 9,007,618 F2089L probably benign Het
Cacnb1 T C 11: 98,005,017 probably benign Het
Cep57 T C 9: 13,818,979 I61V possibly damaging Het
Ckap5 T C 2: 91,550,629 I110T probably benign Het
Clasp2 T C 9: 113,896,634 probably benign Het
Col11a1 A C 3: 114,194,152 E265A probably damaging Het
Cst13 A G 2: 148,830,331 probably benign Het
Cyp24a1 G A 2: 170,491,617 T272M probably damaging Het
Cyp4a14 A C 4: 115,489,996 L415R probably damaging Het
Dbnl T C 11: 5,796,807 F179S probably damaging Het
Eepd1 T C 9: 25,586,783 L388P possibly damaging Het
Exosc8 G T 3: 54,732,738 A55E probably damaging Het
Fam72a G A 1: 131,533,819 V81I probably damaging Het
Fasn C T 11: 120,809,451 M2182I probably benign Het
Fras1 C T 5: 96,714,463 P2234S probably damaging Het
Grn C A 11: 102,433,070 D33E possibly damaging Het
Gsap A G 5: 21,251,165 probably benign Het
Hist1h2bn T A 13: 21,754,247 V42E probably damaging Het
Hook3 T C 8: 26,072,350 Q229R possibly damaging Het
Itgb6 T C 2: 60,650,068 E308G probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Lrrc4c A G 2: 97,629,985 M319V probably benign Het
Mia3 T C 1: 183,357,354 I672M probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mlc1 A G 15: 88,965,461 L223P probably damaging Het
Mmp21 T C 7: 133,674,453 K554E probably benign Het
Nup160 C T 2: 90,693,902 T383I probably damaging Het
Olfr1166 A G 2: 88,124,229 I252T probably damaging Het
Olfr1197 T A 2: 88,729,032 D189V probably damaging Het
Olfr177 T C 16: 58,872,970 Y60C probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Olfr516 T A 7: 108,845,984 T9S probably benign Het
Opcml T A 9: 28,903,299 D290E probably damaging Het
Palm3 C A 8: 84,029,272 T471K probably benign Het
Prl2c5 T A 13: 13,185,907 L50* probably null Het
Pzp T C 6: 128,519,426 N281S probably benign Het
Qser1 T C 2: 104,760,555 Y1722C probably damaging Het
Ryr3 A G 2: 112,869,108 V879A probably benign Het
Sbno1 A G 5: 124,393,912 S736P possibly damaging Het
Sept5 G A 16: 18,623,094 probably benign Het
Slc17a6 A G 7: 51,649,248 probably benign Het
Spag17 A T 3: 100,103,117 T1976S probably benign Het
Swt1 A T 1: 151,370,569 probably benign Het
Tenm4 T C 7: 96,797,481 W853R probably damaging Het
Thbs1 A T 2: 118,123,051 Q983L probably damaging Het
Tmem191c A G 16: 17,276,483 probably benign Het
Tmprss11g A T 5: 86,490,747 V294D probably damaging Het
Tor1aip2 A G 1: 156,065,336 S463G probably benign Het
Ttc1 A G 11: 43,730,499 V285A possibly damaging Het
Uckl1 C T 2: 181,572,485 R303H possibly damaging Het
Vwa8 C A 14: 79,086,654 C1132* probably null Het
Other mutations in Trim36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Trim36 APN 18 46188388 splice site probably benign
IGL02728:Trim36 APN 18 46172602 missense probably benign 0.00
IGL03166:Trim36 APN 18 46212321 missense probably benign
IGL03209:Trim36 APN 18 46167508 missense probably benign
R0346:Trim36 UTSW 18 46199709 unclassified probably benign
R0426:Trim36 UTSW 18 46172525 missense probably damaging 0.97
R0463:Trim36 UTSW 18 46178456 missense possibly damaging 0.89
R0590:Trim36 UTSW 18 46172576 missense probably benign 0.01
R0751:Trim36 UTSW 18 46196251 missense probably damaging 1.00
R1184:Trim36 UTSW 18 46196251 missense probably damaging 1.00
R1522:Trim36 UTSW 18 46186183 nonsense probably null
R1571:Trim36 UTSW 18 46172495 missense probably benign 0.01
R1687:Trim36 UTSW 18 46188657 missense possibly damaging 0.93
R2057:Trim36 UTSW 18 46196162 missense probably benign 0.02
R2103:Trim36 UTSW 18 46196082 missense probably benign
R2127:Trim36 UTSW 18 46212337 missense probably benign 0.27
R3853:Trim36 UTSW 18 46172372 splice site probably benign
R4209:Trim36 UTSW 18 46196124 missense probably benign 0.44
R4787:Trim36 UTSW 18 46172532 missense probably benign 0.10
R4810:Trim36 UTSW 18 46172469 missense probably benign 0.07
R4953:Trim36 UTSW 18 46196178 missense possibly damaging 0.90
R5107:Trim36 UTSW 18 46172638 missense probably benign
R5320:Trim36 UTSW 18 46167498 missense probably damaging 1.00
R5683:Trim36 UTSW 18 46169292 missense probably damaging 1.00
R5823:Trim36 UTSW 18 46169340 missense probably damaging 1.00
R6619:Trim36 UTSW 18 46188408 missense probably damaging 0.96
R7349:Trim36 UTSW 18 46169428 missense probably benign 0.29
R7814:Trim36 UTSW 18 46167624 missense possibly damaging 0.64
R7853:Trim36 UTSW 18 46172491 missense probably benign 0.14
R7936:Trim36 UTSW 18 46172491 missense probably benign 0.14
R8008:Trim36 UTSW 18 46172489 missense probably benign 0.34
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- caagacaggatttctctttggaac -3'
Posted On2014-01-05