Incidental Mutation 'R1051:Kdsr'
ID 93911
Institutional Source Beutler Lab
Gene Symbol Kdsr
Ensembl Gene ENSMUSG00000009905
Gene Name 3-ketodihydrosphingosine reductase
Synonyms 9430079B08Rik, 6330410P18Rik, Fvt1
MMRRC Submission 039141-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.933) question?
Stock # R1051 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 106648189-106687457 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 106675310 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 109 (Q109*)
Ref Sequence ENSEMBL: ENSMUSP00000010049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010049]
AlphaFold Q6GV12
Predicted Effect probably null
Transcript: ENSMUST00000010049
AA Change: Q109*
SMART Domains Protein: ENSMUSP00000010049
Gene: ENSMUSG00000009905
AA Change: Q109*

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:KR 33 214 9.4e-16 PFAM
Pfam:adh_short 33 232 1.1e-59 PFAM
Pfam:adh_short_C2 39 217 5.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187319
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the reduction of 3-ketodihydrosphingosine to dihydrosphingosine. The putative active site residues of the encoded protein are found on the cytosolic side of the endoplasmic reticulum membrane. A chromosomal rearrangement involving this gene is a cause of follicular lymphoma, also known as type II chronic lymphatic leukemia. The mutation of a conserved residue in the bovine ortholog causes spinal muscular atrophy. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A G 5: 121,764,143 (GRCm39) S929P probably damaging Het
Acot1 T C 12: 84,056,378 (GRCm39) V32A probably damaging Het
Ank1 G A 8: 23,583,956 (GRCm39) G353D probably damaging Het
Baiap2l1 T A 5: 144,222,943 (GRCm39) H97L probably damaging Het
Casp8ap2 C A 4: 32,640,790 (GRCm39) P615T probably benign Het
Chrng A T 1: 87,136,785 (GRCm39) D218V possibly damaging Het
Col5a3 C A 9: 20,686,531 (GRCm39) V1365L unknown Het
Ddx49 A G 8: 70,747,335 (GRCm39) probably null Het
Dnaaf2 T C 12: 69,244,569 (GRCm39) D164G probably damaging Het
Eefsec A T 6: 88,274,829 (GRCm39) D378E probably benign Het
Farsb T C 1: 78,420,287 (GRCm39) I535V possibly damaging Het
Fat1 T G 8: 45,497,543 (GRCm39) S4343A probably damaging Het
Fbn2 T C 18: 58,145,425 (GRCm39) Y2737C probably damaging Het
Gtf3c1 T C 7: 125,306,821 (GRCm39) E10G probably damaging Het
Has1 T C 17: 18,068,541 (GRCm39) D271G probably damaging Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Il12rb2 A G 6: 67,333,719 (GRCm39) F187L probably benign Het
Klb G A 5: 65,536,670 (GRCm39) A667T probably damaging Het
Krba1 C T 6: 48,390,332 (GRCm39) R704C possibly damaging Het
Lenep A T 3: 89,309,780 (GRCm39) I56N possibly damaging Het
Lipc T C 9: 70,709,398 (GRCm39) I450V probably benign Het
Myh6 T C 14: 55,186,984 (GRCm39) N1329S probably benign Het
Myo5c T A 9: 75,198,165 (GRCm39) M1330K probably benign Het
Myo9b A G 8: 71,808,466 (GRCm39) E1691G probably damaging Het
Ninl C G 2: 150,812,046 (GRCm39) E240Q probably damaging Het
Nlgn1 T C 3: 25,966,869 (GRCm39) S195G probably damaging Het
Nlrp4c A G 7: 6,068,942 (GRCm39) E281G probably benign Het
Olfm2 T C 9: 20,579,759 (GRCm39) T331A probably damaging Het
Or1o1 A T 17: 37,717,341 (GRCm39) I301F possibly damaging Het
Or2d2 T A 7: 106,728,123 (GRCm39) D159V possibly damaging Het
Or8b9 T C 9: 37,766,657 (GRCm39) I181T probably damaging Het
Plekhh2 T C 17: 84,829,255 (GRCm39) probably null Het
Pramel4 A G 4: 143,795,068 (GRCm39) E485G possibly damaging Het
Prss12 A G 3: 123,279,174 (GRCm39) D417G probably null Het
Rhpn1 A T 15: 75,584,241 (GRCm39) Y456F probably damaging Het
Rnpc3 C T 3: 113,423,595 (GRCm39) E37K possibly damaging Het
Rp1l1 T G 14: 64,269,984 (GRCm39) L1857V probably damaging Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Sepsecs C T 5: 52,822,698 (GRCm39) A18T probably damaging Het
Sgms1 T A 19: 32,137,439 (GRCm39) L42F probably damaging Het
Sipa1l1 A T 12: 82,496,119 (GRCm39) D1720V possibly damaging Het
Slc13a3 A T 2: 165,250,740 (GRCm39) probably null Het
Slc25a40 A T 5: 8,480,450 (GRCm39) M67L probably benign Het
Slc35e1 T C 8: 73,246,415 (GRCm39) probably benign Het
Spesp1 T C 9: 62,179,924 (GRCm39) D328G possibly damaging Het
Sspo T A 6: 48,468,389 (GRCm39) C4363* probably null Het
Tbc1d8 C T 1: 39,420,534 (GRCm39) W666* probably null Het
Tubgcp2 T C 7: 139,578,809 (GRCm39) D721G probably benign Het
Vps54 CTTAAT CT 11: 21,228,001 (GRCm39) probably null Het
Wsb1 T C 11: 79,137,059 (GRCm39) S113G probably damaging Het
Zfp382 T C 7: 29,833,435 (GRCm39) F362S probably damaging Het
Zfp553 G T 7: 126,835,977 (GRCm39) G511* probably null Het
Zfp568 C T 7: 29,721,954 (GRCm39) Q299* probably null Het
Zfp688 G A 7: 127,018,397 (GRCm39) P243S probably damaging Het
Other mutations in Kdsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Kdsr APN 1 106,683,187 (GRCm39) missense possibly damaging 0.91
IGL01375:Kdsr APN 1 106,655,424 (GRCm39) missense probably benign 0.06
R0361:Kdsr UTSW 1 106,675,517 (GRCm39) missense probably damaging 0.97
R1589:Kdsr UTSW 1 106,662,271 (GRCm39) splice site probably null
R1679:Kdsr UTSW 1 106,680,956 (GRCm39) missense probably benign 0.01
R4890:Kdsr UTSW 1 106,680,964 (GRCm39) missense probably benign 0.21
R5392:Kdsr UTSW 1 106,680,971 (GRCm39) missense possibly damaging 0.88
R5500:Kdsr UTSW 1 106,687,374 (GRCm39) unclassified probably benign
R5830:Kdsr UTSW 1 106,675,262 (GRCm39) missense possibly damaging 0.89
R5850:Kdsr UTSW 1 106,683,172 (GRCm39) critical splice donor site probably null
R6005:Kdsr UTSW 1 106,662,311 (GRCm39) missense probably benign 0.01
R7515:Kdsr UTSW 1 106,662,290 (GRCm39) missense possibly damaging 0.89
R7841:Kdsr UTSW 1 106,671,415 (GRCm39) missense probably damaging 1.00
R8282:Kdsr UTSW 1 106,652,727 (GRCm39) missense probably benign 0.03
R8312:Kdsr UTSW 1 106,675,216 (GRCm39) critical splice donor site probably null
R8392:Kdsr UTSW 1 106,671,583 (GRCm39) missense probably damaging 1.00
R8507:Kdsr UTSW 1 106,671,400 (GRCm39) missense probably null 1.00
R8933:Kdsr UTSW 1 106,680,949 (GRCm39) missense possibly damaging 0.70
R9531:Kdsr UTSW 1 106,667,063 (GRCm39) missense probably damaging 0.99
R9740:Kdsr UTSW 1 106,667,126 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGTTCTGACACTGGTCCAGCAGTC -3'
(R):5'- GGTGCTTTCAGTTTCACTGCCTGAC -3'

Sequencing Primer
(F):5'- GAGTCCCTATCACTCTGGTGAAAG -3'
(R):5'- GCCTGACTCTGCTCAGC -3'
Posted On 2014-01-05