Incidental Mutation 'R1051:Ninl'
ID93919
Institutional Source Beutler Lab
Gene Symbol Ninl
Ensembl Gene ENSMUSG00000068115
Gene Nameninein-like
SynonymsLOC381387, LOC381388, 4930519N13Rik
MMRRC Submission 039141-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1051 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location150934519-151039382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 150970126 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 240 (E240Q)
Ref Sequence ENSEMBL: ENSMUSP00000105522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109896] [ENSMUST00000128627] [ENSMUST00000150595]
Predicted Effect probably damaging
Transcript: ENSMUST00000109896
AA Change: E240Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105522
Gene: ENSMUSG00000068115
AA Change: E240Q

DomainStartEndE-ValueType
EFh 12 40 6.56e0 SMART
low complexity region 76 93 N/A INTRINSIC
EFh 201 229 4.45e1 SMART
EFh 238 266 8.98e-4 SMART
low complexity region 295 306 N/A INTRINSIC
coiled coil region 381 423 N/A INTRINSIC
coiled coil region 461 517 N/A INTRINSIC
coiled coil region 541 584 N/A INTRINSIC
coiled coil region 620 699 N/A INTRINSIC
coiled coil region 728 751 N/A INTRINSIC
coiled coil region 835 863 N/A INTRINSIC
coiled coil region 1058 1334 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128564
Predicted Effect probably benign
Transcript: ENSMUST00000128627
SMART Domains Protein: ENSMUSP00000121872
Gene: ENSMUSG00000068115

DomainStartEndE-ValueType
SCOP:d1c07a_ 3 76 3e-7 SMART
PDB:2PMY|B 10 75 1e-6 PDB
Blast:EFh 12 40 4e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149979
Predicted Effect probably benign
Transcript: ENSMUST00000150595
SMART Domains Protein: ENSMUSP00000117001
Gene: ENSMUSG00000068115

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
coiled coil region 85 122 N/A INTRINSIC
coiled coil region 160 216 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit bone-marrow myeloid hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A G 5: 121,626,080 S929P probably damaging Het
Acot1 T C 12: 84,009,604 V32A probably damaging Het
Ank1 G A 8: 23,093,940 G353D probably damaging Het
Baiap2l1 T A 5: 144,286,133 H97L probably damaging Het
Casp8ap2 C A 4: 32,640,790 P615T probably benign Het
Chrng A T 1: 87,209,063 D218V possibly damaging Het
Col5a3 C A 9: 20,775,235 V1365L unknown Het
Ddx49 A G 8: 70,294,685 probably null Het
Dnaaf2 T C 12: 69,197,795 D164G probably damaging Het
Eefsec A T 6: 88,297,847 D378E probably benign Het
Farsb T C 1: 78,443,650 I535V possibly damaging Het
Fat1 T G 8: 45,044,506 S4343A probably damaging Het
Fbn2 T C 18: 58,012,353 Y2737C probably damaging Het
Gtf3c1 T C 7: 125,707,649 E10G probably damaging Het
Has1 T C 17: 17,848,279 D271G probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il12rb2 A G 6: 67,356,735 F187L probably benign Het
Kdsr G A 1: 106,747,580 Q109* probably null Het
Klb G A 5: 65,379,327 A667T probably damaging Het
Krba1 C T 6: 48,413,398 R704C possibly damaging Het
Lenep A T 3: 89,402,473 I56N possibly damaging Het
Lipc T C 9: 70,802,116 I450V probably benign Het
Myh6 T C 14: 54,949,527 N1329S probably benign Het
Myo5c T A 9: 75,290,883 M1330K probably benign Het
Myo9b A G 8: 71,355,822 E1691G probably damaging Het
Nlgn1 T C 3: 25,912,705 S195G probably damaging Het
Nlrp4c A G 7: 6,065,943 E281G probably benign Het
Olfm2 T C 9: 20,668,463 T331A probably damaging Het
Olfr107 A T 17: 37,406,450 I301F possibly damaging Het
Olfr715 T A 7: 107,128,916 D159V possibly damaging Het
Olfr877 T C 9: 37,855,361 I181T probably damaging Het
Plekhh2 T C 17: 84,521,827 probably null Het
Pramel4 A G 4: 144,068,498 E485G possibly damaging Het
Prss12 A G 3: 123,485,525 D417G probably null Het
Rhpn1 A T 15: 75,712,392 Y456F probably damaging Het
Rnpc3 C T 3: 113,629,946 E37K possibly damaging Het
Rp1l1 T G 14: 64,032,535 L1857V probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sepsecs C T 5: 52,665,356 A18T probably damaging Het
Sgms1 T A 19: 32,160,039 L42F probably damaging Het
Sipa1l1 A T 12: 82,449,345 D1720V possibly damaging Het
Slc13a3 A T 2: 165,408,820 probably null Het
Slc25a40 A T 5: 8,430,450 M67L probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Spesp1 T C 9: 62,272,642 D328G possibly damaging Het
Sspo T A 6: 48,491,455 C4363* probably null Het
Tbc1d8 C T 1: 39,381,453 W666* probably null Het
Tubgcp2 T C 7: 139,998,896 D721G probably benign Het
Vps54 CTTAAT CT 11: 21,278,001 probably null Het
Wsb1 T C 11: 79,246,233 S113G probably damaging Het
Zfp382 T C 7: 30,134,010 F362S probably damaging Het
Zfp553 G T 7: 127,236,805 G511* probably null Het
Zfp568 C T 7: 30,022,529 Q299* probably null Het
Zfp688 G A 7: 127,419,225 P243S probably damaging Het
Other mutations in Ninl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Ninl APN 2 150966241 missense probably damaging 0.98
IGL01697:Ninl APN 2 150939947 missense probably damaging 1.00
IGL01756:Ninl APN 2 150979516 missense probably damaging 1.00
IGL01925:Ninl APN 2 150971059 missense probably damaging 1.00
IGL02341:Ninl APN 2 150944605 nonsense probably null
IGL02838:Ninl APN 2 150955711 splice site probably null
IGL02868:Ninl APN 2 150937054 missense probably benign
IGL03116:Ninl APN 2 150964219 missense probably damaging 1.00
IGL03396:Ninl APN 2 150966212 missense possibly damaging 0.88
R0117:Ninl UTSW 2 150937673 missense probably damaging 0.98
R0685:Ninl UTSW 2 150939855 missense possibly damaging 0.73
R0928:Ninl UTSW 2 150963475 missense probably damaging 0.99
R1441:Ninl UTSW 2 150971124 missense probably benign 0.10
R1493:Ninl UTSW 2 150980095 missense probably damaging 1.00
R1499:Ninl UTSW 2 150980176 missense possibly damaging 0.70
R1539:Ninl UTSW 2 150975947 missense probably damaging 1.00
R1658:Ninl UTSW 2 150964159 missense probably damaging 1.00
R2038:Ninl UTSW 2 150975843 nonsense probably null
R2156:Ninl UTSW 2 150944583 missense probably damaging 1.00
R2232:Ninl UTSW 2 150950050 missense probably benign 0.00
R2373:Ninl UTSW 2 150980117 missense probably damaging 1.00
R3743:Ninl UTSW 2 150950248 missense probably benign 0.01
R3906:Ninl UTSW 2 150980119 missense probably damaging 1.00
R3950:Ninl UTSW 2 150952488 missense possibly damaging 0.90
R4283:Ninl UTSW 2 150953416 unclassified probably benign
R4798:Ninl UTSW 2 150959881 nonsense probably null
R4963:Ninl UTSW 2 150939909 missense probably benign 0.04
R4998:Ninl UTSW 2 150953364 missense probably damaging 1.00
R5343:Ninl UTSW 2 150971190 missense probably benign 0.01
R5810:Ninl UTSW 2 150950168 missense probably benign 0.31
R5825:Ninl UTSW 2 150940724 missense probably damaging 1.00
R6436:Ninl UTSW 2 150966178 missense probably damaging 1.00
R6728:Ninl UTSW 2 150975857 nonsense probably null
R6734:Ninl UTSW 2 150945083 critical splice donor site probably null
R6997:Ninl UTSW 2 150966225 missense probably benign 0.08
R7135:Ninl UTSW 2 150955604 missense probably benign 0.00
R7157:Ninl UTSW 2 150949343 missense possibly damaging 0.63
R7315:Ninl UTSW 2 150950050 missense probably benign 0.00
X0062:Ninl UTSW 2 150970046 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTCTATGCTCAGTGCCGTGAC -3'
(R):5'- CTGGTATCCTTGCTGGACCATGAAC -3'

Sequencing Primer
(F):5'- GTGACACTGGCACAATTATCAGC -3'
(R):5'- TTGCTGGACCATGAACTCTAAGG -3'
Posted On2014-01-05