Incidental Mutation 'R1051:Zfp382'
ID93950
Institutional Source Beutler Lab
Gene Symbol Zfp382
Ensembl Gene ENSMUSG00000074220
Gene Namezinc finger protein 382
Synonyms5930415A09Rik
MMRRC Submission 039141-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R1051 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location30121942-30134950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30134010 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 362 (F362S)
Ref Sequence ENSEMBL: ENSMUSP00000096196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098596] [ENSMUST00000153792]
Predicted Effect probably damaging
Transcript: ENSMUST00000098596
AA Change: F362S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096196
Gene: ENSMUSG00000074220
AA Change: F362S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
KRAB 42 102 3.36e-39 SMART
ZnF_C2H2 325 347 1.84e-4 SMART
ZnF_C2H2 353 375 7.26e-3 SMART
ZnF_C2H2 381 403 2.71e-2 SMART
ZnF_C2H2 409 431 4.47e-3 SMART
ZnF_C2H2 437 459 2.12e-4 SMART
ZnF_C2H2 465 487 3.95e-4 SMART
ZnF_C2H2 493 515 1.12e-3 SMART
ZnF_C2H2 521 543 2.57e-3 SMART
ZnF_C2H2 549 571 3.63e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153792
SMART Domains Protein: ENSMUSP00000123508
Gene: ENSMUSG00000074220

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156543
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a KRAB domain zinc finger transcription factor (KZNF). KZNFs play critical roles in the regulation of many cellular processes including differentiation, proliferation and apoptosis. The encoded protein inhibits activating protein 1 (AP-1) and nuclear factor kappa-B (NF-kB) signaling and may function as a tumor suppressor in multiple carcinomas. This gene is found in a cluster with other zinc finger protein genes on the long arm of chromosome 19, and alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A G 5: 121,626,080 S929P probably damaging Het
Acot1 T C 12: 84,009,604 V32A probably damaging Het
Ank1 G A 8: 23,093,940 G353D probably damaging Het
Baiap2l1 T A 5: 144,286,133 H97L probably damaging Het
Casp8ap2 C A 4: 32,640,790 P615T probably benign Het
Chrng A T 1: 87,209,063 D218V possibly damaging Het
Col5a3 C A 9: 20,775,235 V1365L unknown Het
Ddx49 A G 8: 70,294,685 probably null Het
Dnaaf2 T C 12: 69,197,795 D164G probably damaging Het
Eefsec A T 6: 88,297,847 D378E probably benign Het
Farsb T C 1: 78,443,650 I535V possibly damaging Het
Fat1 T G 8: 45,044,506 S4343A probably damaging Het
Fbn2 T C 18: 58,012,353 Y2737C probably damaging Het
Gtf3c1 T C 7: 125,707,649 E10G probably damaging Het
Has1 T C 17: 17,848,279 D271G probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il12rb2 A G 6: 67,356,735 F187L probably benign Het
Kdsr G A 1: 106,747,580 Q109* probably null Het
Klb G A 5: 65,379,327 A667T probably damaging Het
Krba1 C T 6: 48,413,398 R704C possibly damaging Het
Lenep A T 3: 89,402,473 I56N possibly damaging Het
Lipc T C 9: 70,802,116 I450V probably benign Het
Myh6 T C 14: 54,949,527 N1329S probably benign Het
Myo5c T A 9: 75,290,883 M1330K probably benign Het
Myo9b A G 8: 71,355,822 E1691G probably damaging Het
Ninl C G 2: 150,970,126 E240Q probably damaging Het
Nlgn1 T C 3: 25,912,705 S195G probably damaging Het
Nlrp4c A G 7: 6,065,943 E281G probably benign Het
Olfm2 T C 9: 20,668,463 T331A probably damaging Het
Olfr107 A T 17: 37,406,450 I301F possibly damaging Het
Olfr715 T A 7: 107,128,916 D159V possibly damaging Het
Olfr877 T C 9: 37,855,361 I181T probably damaging Het
Plekhh2 T C 17: 84,521,827 probably null Het
Pramel4 A G 4: 144,068,498 E485G possibly damaging Het
Prss12 A G 3: 123,485,525 D417G probably null Het
Rhpn1 A T 15: 75,712,392 Y456F probably damaging Het
Rnpc3 C T 3: 113,629,946 E37K possibly damaging Het
Rp1l1 T G 14: 64,032,535 L1857V probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sepsecs C T 5: 52,665,356 A18T probably damaging Het
Sgms1 T A 19: 32,160,039 L42F probably damaging Het
Sipa1l1 A T 12: 82,449,345 D1720V possibly damaging Het
Slc13a3 A T 2: 165,408,820 probably null Het
Slc25a40 A T 5: 8,430,450 M67L probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Spesp1 T C 9: 62,272,642 D328G possibly damaging Het
Sspo T A 6: 48,491,455 C4363* probably null Het
Tbc1d8 C T 1: 39,381,453 W666* probably null Het
Tubgcp2 T C 7: 139,998,896 D721G probably benign Het
Vps54 CTTAAT CT 11: 21,278,001 probably null Het
Wsb1 T C 11: 79,246,233 S113G probably damaging Het
Zfp553 G T 7: 127,236,805 G511* probably null Het
Zfp568 C T 7: 30,022,529 Q299* probably null Het
Zfp688 G A 7: 127,419,225 P243S probably damaging Het
Other mutations in Zfp382
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02724:Zfp382 APN 7 30133737 missense probably benign 0.00
IGL03116:Zfp382 APN 7 30134189 missense probably damaging 1.00
R1371:Zfp382 UTSW 7 30133689 missense probably benign 0.36
R1513:Zfp382 UTSW 7 30133296 missense probably benign 0.04
R1525:Zfp382 UTSW 7 30133719 missense probably damaging 0.99
R2416:Zfp382 UTSW 7 30134403 missense probably damaging 1.00
R2432:Zfp382 UTSW 7 30133749 missense probably benign
R4864:Zfp382 UTSW 7 30133460 missense possibly damaging 0.58
R4956:Zfp382 UTSW 7 30131554 missense probably benign 0.00
R5734:Zfp382 UTSW 7 30134430 missense probably damaging 1.00
R5796:Zfp382 UTSW 7 30133349 missense probably damaging 1.00
R6062:Zfp382 UTSW 7 30133590 missense probably damaging 1.00
R6300:Zfp382 UTSW 7 30131629 splice site probably null
R6312:Zfp382 UTSW 7 30134538 missense probably damaging 0.99
R6894:Zfp382 UTSW 7 30125836 missense probably benign
R7764:Zfp382 UTSW 7 30133275 missense probably benign 0.04
R7771:Zfp382 UTSW 7 30133335 missense probably damaging 1.00
R7794:Zfp382 UTSW 7 30131610 missense possibly damaging 0.84
R8207:Zfp382 UTSW 7 30134415 missense possibly damaging 0.74
R8267:Zfp382 UTSW 7 30134504 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTATGCACCCCAGCTCTCAGAT -3'
(R):5'- GGTGGGTAATGAGGTTCGATTTACAGC -3'

Sequencing Primer
(F):5'- CAGCTCTCAGATGGACGAG -3'
(R):5'- aacgccttcccacactc -3'
Posted On2014-01-05