Incidental Mutation 'R1051:Slc35e1'
ID93963
Institutional Source Beutler Lab
Gene Symbol Slc35e1
Ensembl Gene ENSMUSG00000019731
Gene Namesolute carrier family 35, member E1
Synonyms
MMRRC Submission 039141-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R1051 (G1)
Quality Score125
Status Not validated
Chromosome8
Chromosomal Location72480641-72492614 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 72492571 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000058697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058534] [ENSMUST00000152080]
Predicted Effect probably benign
Transcript: ENSMUST00000058534
SMART Domains Protein: ENSMUSP00000058697
Gene: ENSMUSG00000045248

DomainStartEndE-ValueType
TFS2N 12 86 6.67e-21 SMART
low complexity region 93 108 N/A INTRINSIC
Pfam:Med26_M 177 405 3e-80 PFAM
Pfam:Med26_C 407 586 5.1e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141352
SMART Domains Protein: ENSMUSP00000122215
Gene: ENSMUSG00000019731

DomainStartEndE-ValueType
Pfam:EamA 5 58 1.5e-6 PFAM
Pfam:UAA 6 214 4e-8 PFAM
Pfam:TPT 67 211 1.7e-38 PFAM
Pfam:EamA 76 211 1.4e-6 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000152080
AA Change: T6A
SMART Domains Protein: ENSMUSP00000115754
Gene: ENSMUSG00000019731
AA Change: T6A

DomainStartEndE-ValueType
Pfam:TPT 28 333 8.3e-95 PFAM
Pfam:EamA 188 334 7.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212699
Meta Mutation Damage Score 0.0528 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A G 5: 121,626,080 S929P probably damaging Het
Acot1 T C 12: 84,009,604 V32A probably damaging Het
Ank1 G A 8: 23,093,940 G353D probably damaging Het
Baiap2l1 T A 5: 144,286,133 H97L probably damaging Het
Casp8ap2 C A 4: 32,640,790 P615T probably benign Het
Chrng A T 1: 87,209,063 D218V possibly damaging Het
Col5a3 C A 9: 20,775,235 V1365L unknown Het
Ddx49 A G 8: 70,294,685 probably null Het
Dnaaf2 T C 12: 69,197,795 D164G probably damaging Het
Eefsec A T 6: 88,297,847 D378E probably benign Het
Farsb T C 1: 78,443,650 I535V possibly damaging Het
Fat1 T G 8: 45,044,506 S4343A probably damaging Het
Fbn2 T C 18: 58,012,353 Y2737C probably damaging Het
Gtf3c1 T C 7: 125,707,649 E10G probably damaging Het
Has1 T C 17: 17,848,279 D271G probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il12rb2 A G 6: 67,356,735 F187L probably benign Het
Kdsr G A 1: 106,747,580 Q109* probably null Het
Klb G A 5: 65,379,327 A667T probably damaging Het
Krba1 C T 6: 48,413,398 R704C possibly damaging Het
Lenep A T 3: 89,402,473 I56N possibly damaging Het
Lipc T C 9: 70,802,116 I450V probably benign Het
Myh6 T C 14: 54,949,527 N1329S probably benign Het
Myo5c T A 9: 75,290,883 M1330K probably benign Het
Myo9b A G 8: 71,355,822 E1691G probably damaging Het
Ninl C G 2: 150,970,126 E240Q probably damaging Het
Nlgn1 T C 3: 25,912,705 S195G probably damaging Het
Nlrp4c A G 7: 6,065,943 E281G probably benign Het
Olfm2 T C 9: 20,668,463 T331A probably damaging Het
Olfr107 A T 17: 37,406,450 I301F possibly damaging Het
Olfr715 T A 7: 107,128,916 D159V possibly damaging Het
Olfr877 T C 9: 37,855,361 I181T probably damaging Het
Plekhh2 T C 17: 84,521,827 probably null Het
Pramel4 A G 4: 144,068,498 E485G possibly damaging Het
Prss12 A G 3: 123,485,525 D417G probably null Het
Rhpn1 A T 15: 75,712,392 Y456F probably damaging Het
Rnpc3 C T 3: 113,629,946 E37K possibly damaging Het
Rp1l1 T G 14: 64,032,535 L1857V probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sepsecs C T 5: 52,665,356 A18T probably damaging Het
Sgms1 T A 19: 32,160,039 L42F probably damaging Het
Sipa1l1 A T 12: 82,449,345 D1720V possibly damaging Het
Slc13a3 A T 2: 165,408,820 probably null Het
Slc25a40 A T 5: 8,430,450 M67L probably benign Het
Spesp1 T C 9: 62,272,642 D328G possibly damaging Het
Sspo T A 6: 48,491,455 C4363* probably null Het
Tbc1d8 C T 1: 39,381,453 W666* probably null Het
Tubgcp2 T C 7: 139,998,896 D721G probably benign Het
Vps54 CTTAAT CT 11: 21,278,001 probably null Het
Wsb1 T C 11: 79,246,233 S113G probably damaging Het
Zfp382 T C 7: 30,134,010 F362S probably damaging Het
Zfp553 G T 7: 127,236,805 G511* probably null Het
Zfp568 C T 7: 30,022,529 Q299* probably null Het
Zfp688 G A 7: 127,419,225 P243S probably damaging Het
Other mutations in Slc35e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Slc35e1 APN 8 72483758 utr 3 prime probably benign
IGL01399:Slc35e1 APN 8 72484690 missense probably damaging 1.00
IGL02663:Slc35e1 APN 8 72488209 missense probably damaging 1.00
IGL03349:Slc35e1 APN 8 72483852 missense probably damaging 0.99
R0009:Slc35e1 UTSW 8 72484709 missense probably damaging 1.00
R0009:Slc35e1 UTSW 8 72484709 missense probably damaging 1.00
R0054:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0105:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0401:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0510:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0511:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0529:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0566:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0968:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0969:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1029:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1123:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1245:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1247:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1314:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1343:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1357:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1401:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1430:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1715:Slc35e1 UTSW 8 72483977 missense probably benign 0.05
R3031:Slc35e1 UTSW 8 72484891 missense probably benign 0.03
R3769:Slc35e1 UTSW 8 72491870 missense possibly damaging 0.89
R4745:Slc35e1 UTSW 8 72492322 missense possibly damaging 0.81
R6884:Slc35e1 UTSW 8 72484882 missense possibly damaging 0.77
R7309:Slc35e1 UTSW 8 72492514 missense unknown
Predicted Primers PCR Primer
(F):5'- ACGGGAAGGCGCTCAAAATCAC -3'
(R):5'- AGGGGAAATTGACACCTACCGCAC -3'

Sequencing Primer
(F):5'- GCGCTCAAAATCACCTTGTTG -3'
(R):5'- GCGTAGTCCAGAGGATTTACC -3'
Posted On2014-01-05