Incidental Mutation 'R1051:Wsb1'
ID93980
Institutional Source Beutler Lab
Gene Symbol Wsb1
Ensembl Gene ENSMUSG00000017677
Gene NameWD repeat and SOCS box-containing 1
Synonyms
MMRRC Submission 039141-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.377) question?
Stock #R1051 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location79239372-79254671 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79246233 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 113 (S113G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017821] [ENSMUST00000131848] [ENSMUST00000145772]
Predicted Effect probably damaging
Transcript: ENSMUST00000017821
AA Change: S183G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000017821
Gene: ENSMUSG00000017677
AA Change: S183G

DomainStartEndE-ValueType
Blast:WD40 25 62 2e-16 BLAST
WD40 117 156 8.4e-2 SMART
WD40 159 199 2.5e-10 SMART
WD40 203 242 5.9e-10 SMART
WD40 245 284 2.9e-11 SMART
WD40 300 339 1.2e-5 SMART
WD40 342 379 1.1e-4 SMART
SOCS 378 420 2.7e-18 SMART
SOCS_box 384 420 4.1e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131818
AA Change: S113G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131290
Gene: ENSMUSG00000017677
AA Change: S113G

DomainStartEndE-ValueType
WD40 48 87 1.33e1 SMART
WD40 90 130 3.72e-8 SMART
WD40 134 172 4.18e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131848
SMART Domains Protein: ENSMUSP00000128181
Gene: ENSMUSG00000017677

DomainStartEndE-ValueType
Blast:WD40 25 62 2e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137890
Predicted Effect probably benign
Transcript: ENSMUST00000145772
SMART Domains Protein: ENSMUSP00000137999
Gene: ENSMUSG00000017677

DomainStartEndE-ValueType
Blast:WD40 25 62 3e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153585
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD-protein subfamily. This protein shares a high sequence identity to mouse and chick proteins. It contains several WD-repeats spanning most of the protein and an SOCS box in the C-terminus. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A G 5: 121,626,080 S929P probably damaging Het
Acot1 T C 12: 84,009,604 V32A probably damaging Het
Ank1 G A 8: 23,093,940 G353D probably damaging Het
Baiap2l1 T A 5: 144,286,133 H97L probably damaging Het
Casp8ap2 C A 4: 32,640,790 P615T probably benign Het
Chrng A T 1: 87,209,063 D218V possibly damaging Het
Col5a3 C A 9: 20,775,235 V1365L unknown Het
Ddx49 A G 8: 70,294,685 probably null Het
Dnaaf2 T C 12: 69,197,795 D164G probably damaging Het
Eefsec A T 6: 88,297,847 D378E probably benign Het
Farsb T C 1: 78,443,650 I535V possibly damaging Het
Fat1 T G 8: 45,044,506 S4343A probably damaging Het
Fbn2 T C 18: 58,012,353 Y2737C probably damaging Het
Gtf3c1 T C 7: 125,707,649 E10G probably damaging Het
Has1 T C 17: 17,848,279 D271G probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il12rb2 A G 6: 67,356,735 F187L probably benign Het
Kdsr G A 1: 106,747,580 Q109* probably null Het
Klb G A 5: 65,379,327 A667T probably damaging Het
Krba1 C T 6: 48,413,398 R704C possibly damaging Het
Lenep A T 3: 89,402,473 I56N possibly damaging Het
Lipc T C 9: 70,802,116 I450V probably benign Het
Myh6 T C 14: 54,949,527 N1329S probably benign Het
Myo5c T A 9: 75,290,883 M1330K probably benign Het
Myo9b A G 8: 71,355,822 E1691G probably damaging Het
Ninl C G 2: 150,970,126 E240Q probably damaging Het
Nlgn1 T C 3: 25,912,705 S195G probably damaging Het
Nlrp4c A G 7: 6,065,943 E281G probably benign Het
Olfm2 T C 9: 20,668,463 T331A probably damaging Het
Olfr107 A T 17: 37,406,450 I301F possibly damaging Het
Olfr715 T A 7: 107,128,916 D159V possibly damaging Het
Olfr877 T C 9: 37,855,361 I181T probably damaging Het
Plekhh2 T C 17: 84,521,827 probably null Het
Pramel4 A G 4: 144,068,498 E485G possibly damaging Het
Prss12 A G 3: 123,485,525 D417G probably null Het
Rhpn1 A T 15: 75,712,392 Y456F probably damaging Het
Rnpc3 C T 3: 113,629,946 E37K possibly damaging Het
Rp1l1 T G 14: 64,032,535 L1857V probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sepsecs C T 5: 52,665,356 A18T probably damaging Het
Sgms1 T A 19: 32,160,039 L42F probably damaging Het
Sipa1l1 A T 12: 82,449,345 D1720V possibly damaging Het
Slc13a3 A T 2: 165,408,820 probably null Het
Slc25a40 A T 5: 8,430,450 M67L probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Spesp1 T C 9: 62,272,642 D328G possibly damaging Het
Sspo T A 6: 48,491,455 C4363* probably null Het
Tbc1d8 C T 1: 39,381,453 W666* probably null Het
Tubgcp2 T C 7: 139,998,896 D721G probably benign Het
Vps54 CTTAAT CT 11: 21,278,001 probably null Het
Zfp382 T C 7: 30,134,010 F362S probably damaging Het
Zfp553 G T 7: 127,236,805 G511* probably null Het
Zfp568 C T 7: 30,022,529 Q299* probably null Het
Zfp688 G A 7: 127,419,225 P243S probably damaging Het
Other mutations in Wsb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01760:Wsb1 APN 11 79242041 missense probably damaging 1.00
IGL02352:Wsb1 APN 11 79251012 missense probably damaging 1.00
IGL02359:Wsb1 APN 11 79251012 missense probably damaging 1.00
IGL03218:Wsb1 APN 11 79248498 missense probably damaging 0.97
R0488:Wsb1 UTSW 11 79244500 missense probably damaging 1.00
R1612:Wsb1 UTSW 11 79248585 missense probably benign 0.31
R2202:Wsb1 UTSW 11 79240386 missense probably benign
R2449:Wsb1 UTSW 11 79240352 missense probably benign
R4782:Wsb1 UTSW 11 79240373 missense probably benign 0.44
R4805:Wsb1 UTSW 11 79240391 missense possibly damaging 0.95
R4932:Wsb1 UTSW 11 79251000 missense probably damaging 0.96
R5458:Wsb1 UTSW 11 79248436 missense probably damaging 1.00
R6032:Wsb1 UTSW 11 79240199 unclassified probably benign
R6032:Wsb1 UTSW 11 79240199 unclassified probably benign
R6140:Wsb1 UTSW 11 79241618 missense probably damaging 0.98
R6192:Wsb1 UTSW 11 79248510 missense possibly damaging 0.94
R6498:Wsb1 UTSW 11 79248489 missense probably damaging 1.00
R6545:Wsb1 UTSW 11 79251055 missense probably damaging 1.00
R6608:Wsb1 UTSW 11 79240362 missense probably benign 0.30
R7142:Wsb1 UTSW 11 79250988 missense probably benign 0.01
R7339:Wsb1 UTSW 11 79240358 missense probably damaging 0.97
R7361:Wsb1 UTSW 11 79240797 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AAGGGCAATCCCCACATCTCTCTG -3'
(R):5'- GGAGCATTTGATGGTCCAAGGTCAAAG -3'

Sequencing Primer
(F):5'- caagaggcagaggcagg -3'
(R):5'- GAGTTGTAGATTCTCACAGCTAACG -3'
Posted On2014-01-05