Incidental Mutation 'R1051:Sipa1l1'
ID93984
Institutional Source Beutler Lab
Gene Symbol Sipa1l1
Ensembl Gene ENSMUSG00000042700
Gene Namesignal-induced proliferation-associated 1 like 1
Synonyms4931426N11Rik, Spar
MMRRC Submission 039141-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1051 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location82169320-82451786 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82449345 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1720 (D1720V)
Ref Sequence ENSEMBL: ENSMUSP00000152212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053969] [ENSMUST00000166429] [ENSMUST00000220963] [ENSMUST00000222298] [ENSMUST00000222714]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053969
AA Change: D1720V

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000061014
Gene: ENSMUSG00000042700
AA Change: D1720V

DomainStartEndE-ValueType
low complexity region 92 129 N/A INTRINSIC
low complexity region 362 377 N/A INTRINSIC
low complexity region 430 449 N/A INTRINSIC
Pfam:Rap_GAP 628 810 8.9e-70 PFAM
PDZ 962 1028 2.63e-9 SMART
low complexity region 1149 1164 N/A INTRINSIC
low complexity region 1255 1279 N/A INTRINSIC
low complexity region 1315 1328 N/A INTRINSIC
low complexity region 1432 1447 N/A INTRINSIC
Pfam:SPAR_C 1483 1727 4.4e-86 PFAM
low complexity region 1731 1746 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166429
AA Change: D1720V

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131030
Gene: ENSMUSG00000042700
AA Change: D1720V

DomainStartEndE-ValueType
low complexity region 92 129 N/A INTRINSIC
low complexity region 362 377 N/A INTRINSIC
low complexity region 430 449 N/A INTRINSIC
Pfam:Rap_GAP 628 816 1.3e-64 PFAM
PDZ 962 1028 1.3e-11 SMART
low complexity region 1149 1164 N/A INTRINSIC
low complexity region 1255 1279 N/A INTRINSIC
low complexity region 1315 1328 N/A INTRINSIC
low complexity region 1432 1447 N/A INTRINSIC
Pfam:DUF3401 1483 1727 1.8e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220963
Predicted Effect possibly damaging
Transcript: ENSMUST00000222298
AA Change: D1720V

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000222714
AA Change: D1720V

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A G 5: 121,626,080 S929P probably damaging Het
Acot1 T C 12: 84,009,604 V32A probably damaging Het
Ank1 G A 8: 23,093,940 G353D probably damaging Het
Baiap2l1 T A 5: 144,286,133 H97L probably damaging Het
Casp8ap2 C A 4: 32,640,790 P615T probably benign Het
Chrng A T 1: 87,209,063 D218V possibly damaging Het
Col5a3 C A 9: 20,775,235 V1365L unknown Het
Ddx49 A G 8: 70,294,685 probably null Het
Dnaaf2 T C 12: 69,197,795 D164G probably damaging Het
Eefsec A T 6: 88,297,847 D378E probably benign Het
Farsb T C 1: 78,443,650 I535V possibly damaging Het
Fat1 T G 8: 45,044,506 S4343A probably damaging Het
Fbn2 T C 18: 58,012,353 Y2737C probably damaging Het
Gtf3c1 T C 7: 125,707,649 E10G probably damaging Het
Has1 T C 17: 17,848,279 D271G probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il12rb2 A G 6: 67,356,735 F187L probably benign Het
Kdsr G A 1: 106,747,580 Q109* probably null Het
Klb G A 5: 65,379,327 A667T probably damaging Het
Krba1 C T 6: 48,413,398 R704C possibly damaging Het
Lenep A T 3: 89,402,473 I56N possibly damaging Het
Lipc T C 9: 70,802,116 I450V probably benign Het
Myh6 T C 14: 54,949,527 N1329S probably benign Het
Myo5c T A 9: 75,290,883 M1330K probably benign Het
Myo9b A G 8: 71,355,822 E1691G probably damaging Het
Ninl C G 2: 150,970,126 E240Q probably damaging Het
Nlgn1 T C 3: 25,912,705 S195G probably damaging Het
Nlrp4c A G 7: 6,065,943 E281G probably benign Het
Olfm2 T C 9: 20,668,463 T331A probably damaging Het
Olfr107 A T 17: 37,406,450 I301F possibly damaging Het
Olfr715 T A 7: 107,128,916 D159V possibly damaging Het
Olfr877 T C 9: 37,855,361 I181T probably damaging Het
Plekhh2 T C 17: 84,521,827 probably null Het
Pramel4 A G 4: 144,068,498 E485G possibly damaging Het
Prss12 A G 3: 123,485,525 D417G probably null Het
Rhpn1 A T 15: 75,712,392 Y456F probably damaging Het
Rnpc3 C T 3: 113,629,946 E37K possibly damaging Het
Rp1l1 T G 14: 64,032,535 L1857V probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sepsecs C T 5: 52,665,356 A18T probably damaging Het
Sgms1 T A 19: 32,160,039 L42F probably damaging Het
Slc13a3 A T 2: 165,408,820 probably null Het
Slc25a40 A T 5: 8,430,450 M67L probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Spesp1 T C 9: 62,272,642 D328G possibly damaging Het
Sspo T A 6: 48,491,455 C4363* probably null Het
Tbc1d8 C T 1: 39,381,453 W666* probably null Het
Tubgcp2 T C 7: 139,998,896 D721G probably benign Het
Vps54 CTTAAT CT 11: 21,278,001 probably null Het
Wsb1 T C 11: 79,246,233 S113G probably damaging Het
Zfp382 T C 7: 30,134,010 F362S probably damaging Het
Zfp553 G T 7: 127,236,805 G511* probably null Het
Zfp568 C T 7: 30,022,529 Q299* probably null Het
Zfp688 G A 7: 127,419,225 P243S probably damaging Het
Other mutations in Sipa1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Sipa1l1 APN 12 82387696 missense probably benign 0.06
IGL01478:Sipa1l1 APN 12 82446898 missense probably benign 0.00
IGL01620:Sipa1l1 APN 12 82422489 missense probably damaging 0.97
IGL02496:Sipa1l1 APN 12 82425094 missense probably damaging 1.00
IGL02550:Sipa1l1 APN 12 82440949 nonsense probably null
IGL02689:Sipa1l1 APN 12 82440820 missense probably benign 0.01
IGL02706:Sipa1l1 APN 12 82397433 missense possibly damaging 0.95
IGL02995:Sipa1l1 APN 12 82357331 missense probably benign 0.39
IGL03104:Sipa1l1 APN 12 82342130 missense probably benign 0.05
IGL03295:Sipa1l1 APN 12 82432940 missense probably damaging 1.00
bullae UTSW 12 82342250 missense probably damaging 1.00
bullish UTSW 12 82422471 nonsense probably null
ebullient UTSW 12 82341672 missense probably benign 0.18
PIT4431001:Sipa1l1 UTSW 12 82396516 missense probably benign 0.34
R0140:Sipa1l1 UTSW 12 82396200 missense probably damaging 1.00
R0348:Sipa1l1 UTSW 12 82384756 critical splice donor site probably null
R0534:Sipa1l1 UTSW 12 82425280 missense possibly damaging 0.94
R0538:Sipa1l1 UTSW 12 82425099 missense probably benign 0.00
R0547:Sipa1l1 UTSW 12 82437736 missense probably benign
R0980:Sipa1l1 UTSW 12 82342220 missense possibly damaging 0.60
R1244:Sipa1l1 UTSW 12 82425416 missense probably benign 0.00
R1473:Sipa1l1 UTSW 12 82341111 missense probably damaging 1.00
R1508:Sipa1l1 UTSW 12 82440893 missense probably damaging 1.00
R1563:Sipa1l1 UTSW 12 82341161 missense probably benign 0.31
R1671:Sipa1l1 UTSW 12 82397461 missense probably damaging 1.00
R1935:Sipa1l1 UTSW 12 82372434 missense probably damaging 1.00
R1950:Sipa1l1 UTSW 12 82341459 missense probably damaging 0.98
R2191:Sipa1l1 UTSW 12 82396691 nonsense probably null
R2249:Sipa1l1 UTSW 12 82342116 missense probably benign
R2909:Sipa1l1 UTSW 12 82357331 missense probably benign 0.39
R4012:Sipa1l1 UTSW 12 82341782 missense possibly damaging 0.86
R4154:Sipa1l1 UTSW 12 82425214 missense possibly damaging 0.95
R4382:Sipa1l1 UTSW 12 82446822 missense possibly damaging 0.46
R4448:Sipa1l1 UTSW 12 82341750 missense probably benign 0.15
R4651:Sipa1l1 UTSW 12 82422471 nonsense probably null
R4652:Sipa1l1 UTSW 12 82422471 nonsense probably null
R4751:Sipa1l1 UTSW 12 82341194 missense probably benign
R4755:Sipa1l1 UTSW 12 82372386 missense possibly damaging 0.74
R4888:Sipa1l1 UTSW 12 82342333 missense probably damaging 0.96
R4912:Sipa1l1 UTSW 12 82396678 missense possibly damaging 0.89
R4937:Sipa1l1 UTSW 12 82341329 missense probably benign 0.01
R5068:Sipa1l1 UTSW 12 82437827 missense probably damaging 1.00
R5113:Sipa1l1 UTSW 12 82440908 missense probably benign 0.11
R5114:Sipa1l1 UTSW 12 82440908 missense probably benign 0.11
R5240:Sipa1l1 UTSW 12 82341588 missense possibly damaging 0.92
R6041:Sipa1l1 UTSW 12 82342250 missense probably damaging 1.00
R6048:Sipa1l1 UTSW 12 82440869 missense probably benign 0.03
R6170:Sipa1l1 UTSW 12 82341672 missense probably benign 0.18
R6185:Sipa1l1 UTSW 12 82425028 missense probably damaging 1.00
R6326:Sipa1l1 UTSW 12 82372468 missense probably damaging 1.00
R6842:Sipa1l1 UTSW 12 82420546 missense probably benign 0.00
R7008:Sipa1l1 UTSW 12 82363112 missense probably damaging 0.99
R7058:Sipa1l1 UTSW 12 82403122 missense probably benign 0.00
R7069:Sipa1l1 UTSW 12 82341406 missense probably damaging 0.99
R7122:Sipa1l1 UTSW 12 82422462 missense possibly damaging 0.79
R7310:Sipa1l1 UTSW 12 82372495 missense probably damaging 1.00
R7469:Sipa1l1 UTSW 12 82420664 critical splice donor site probably null
R7718:Sipa1l1 UTSW 12 82342497 missense probably damaging 1.00
R7787:Sipa1l1 UTSW 12 82449988 missense possibly damaging 0.81
R7844:Sipa1l1 UTSW 12 82397493 missense probably damaging 1.00
R7893:Sipa1l1 UTSW 12 82341568 missense probably benign 0.00
R7927:Sipa1l1 UTSW 12 82397493 missense probably damaging 1.00
R7976:Sipa1l1 UTSW 12 82341568 missense probably benign 0.00
R8043:Sipa1l1 UTSW 12 82449926 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGCCTCCTGTGCTACCAAAG -3'
(R):5'- TCTATTGCTGCCCTAAACACATGCG -3'

Sequencing Primer
(F):5'- CTCTTTAACAGAGGAAGCTGCTG -3'
(R):5'- GTAAAAACCCAGGCACATCG -3'
Posted On2014-01-05