Incidental Mutation 'R1051:Rhpn1'
ID93991
Institutional Source Beutler Lab
Gene Symbol Rhpn1
Ensembl Gene ENSMUSG00000022580
Gene Namerhophilin, Rho GTPase binding protein 1
SynonymsGrbp, Rhophilin
MMRRC Submission 039141-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1051 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location75704280-75715485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75712392 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 456 (Y456F)
Ref Sequence ENSEMBL: ENSMUSP00000113042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023244] [ENSMUST00000121137] [ENSMUST00000149407]
Predicted Effect probably damaging
Transcript: ENSMUST00000023244
AA Change: Y456F

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023244
Gene: ENSMUSG00000022580
AA Change: Y456F

DomainStartEndE-ValueType
Hr1 42 105 1.98e-17 SMART
BRO1 115 498 4.31e-147 SMART
PDZ 508 578 9.27e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121137
AA Change: Y456F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113042
Gene: ENSMUSG00000022580
AA Change: Y456F

DomainStartEndE-ValueType
Hr1 42 105 1.98e-17 SMART
BRO1 115 516 1.64e-161 SMART
PDZ 526 596 9.27e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143056
Predicted Effect silent
Transcript: ENSMUST00000149407
SMART Domains Protein: ENSMUSP00000116837
Gene: ENSMUSG00000022580

DomainStartEndE-ValueType
Hr1 42 105 1.98e-17 SMART
BRO1 115 449 7.17e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229843
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A G 5: 121,626,080 S929P probably damaging Het
Acot1 T C 12: 84,009,604 V32A probably damaging Het
Ank1 G A 8: 23,093,940 G353D probably damaging Het
Baiap2l1 T A 5: 144,286,133 H97L probably damaging Het
Casp8ap2 C A 4: 32,640,790 P615T probably benign Het
Chrng A T 1: 87,209,063 D218V possibly damaging Het
Col5a3 C A 9: 20,775,235 V1365L unknown Het
Ddx49 A G 8: 70,294,685 probably null Het
Dnaaf2 T C 12: 69,197,795 D164G probably damaging Het
Eefsec A T 6: 88,297,847 D378E probably benign Het
Farsb T C 1: 78,443,650 I535V possibly damaging Het
Fat1 T G 8: 45,044,506 S4343A probably damaging Het
Fbn2 T C 18: 58,012,353 Y2737C probably damaging Het
Gtf3c1 T C 7: 125,707,649 E10G probably damaging Het
Has1 T C 17: 17,848,279 D271G probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il12rb2 A G 6: 67,356,735 F187L probably benign Het
Kdsr G A 1: 106,747,580 Q109* probably null Het
Klb G A 5: 65,379,327 A667T probably damaging Het
Krba1 C T 6: 48,413,398 R704C possibly damaging Het
Lenep A T 3: 89,402,473 I56N possibly damaging Het
Lipc T C 9: 70,802,116 I450V probably benign Het
Myh6 T C 14: 54,949,527 N1329S probably benign Het
Myo5c T A 9: 75,290,883 M1330K probably benign Het
Myo9b A G 8: 71,355,822 E1691G probably damaging Het
Ninl C G 2: 150,970,126 E240Q probably damaging Het
Nlgn1 T C 3: 25,912,705 S195G probably damaging Het
Nlrp4c A G 7: 6,065,943 E281G probably benign Het
Olfm2 T C 9: 20,668,463 T331A probably damaging Het
Olfr107 A T 17: 37,406,450 I301F possibly damaging Het
Olfr715 T A 7: 107,128,916 D159V possibly damaging Het
Olfr877 T C 9: 37,855,361 I181T probably damaging Het
Plekhh2 T C 17: 84,521,827 probably null Het
Pramel4 A G 4: 144,068,498 E485G possibly damaging Het
Prss12 A G 3: 123,485,525 D417G probably null Het
Rnpc3 C T 3: 113,629,946 E37K possibly damaging Het
Rp1l1 T G 14: 64,032,535 L1857V probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sepsecs C T 5: 52,665,356 A18T probably damaging Het
Sgms1 T A 19: 32,160,039 L42F probably damaging Het
Sipa1l1 A T 12: 82,449,345 D1720V possibly damaging Het
Slc13a3 A T 2: 165,408,820 probably null Het
Slc25a40 A T 5: 8,430,450 M67L probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Spesp1 T C 9: 62,272,642 D328G possibly damaging Het
Sspo T A 6: 48,491,455 C4363* probably null Het
Tbc1d8 C T 1: 39,381,453 W666* probably null Het
Tubgcp2 T C 7: 139,998,896 D721G probably benign Het
Vps54 CTTAAT CT 11: 21,278,001 probably null Het
Wsb1 T C 11: 79,246,233 S113G probably damaging Het
Zfp382 T C 7: 30,134,010 F362S probably damaging Het
Zfp553 G T 7: 127,236,805 G511* probably null Het
Zfp568 C T 7: 30,022,529 Q299* probably null Het
Zfp688 G A 7: 127,419,225 P243S probably damaging Het
Other mutations in Rhpn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Rhpn1 APN 15 75711886 missense probably damaging 0.99
IGL02211:Rhpn1 APN 15 75711056 missense possibly damaging 0.94
R0049:Rhpn1 UTSW 15 75709239 missense possibly damaging 0.73
R0049:Rhpn1 UTSW 15 75709239 missense possibly damaging 0.73
R0240:Rhpn1 UTSW 15 75714122 missense probably benign 0.05
R0240:Rhpn1 UTSW 15 75714122 missense probably benign 0.05
R0324:Rhpn1 UTSW 15 75711588 missense probably damaging 0.99
R0426:Rhpn1 UTSW 15 75711872 missense possibly damaging 0.71
R0453:Rhpn1 UTSW 15 75713579 missense possibly damaging 0.93
R0893:Rhpn1 UTSW 15 75711654 missense probably damaging 1.00
R1571:Rhpn1 UTSW 15 75714118 missense possibly damaging 0.93
R1906:Rhpn1 UTSW 15 75711824 missense probably benign 0.02
R1907:Rhpn1 UTSW 15 75711824 missense probably benign 0.02
R2110:Rhpn1 UTSW 15 75713234 missense probably damaging 1.00
R2153:Rhpn1 UTSW 15 75704394 start codon destroyed probably null 0.00
R3943:Rhpn1 UTSW 15 75711806 missense probably damaging 0.97
R4030:Rhpn1 UTSW 15 75710557 missense probably damaging 1.00
R4552:Rhpn1 UTSW 15 75714119 missense probably benign 0.00
R5015:Rhpn1 UTSW 15 75708241 missense probably damaging 1.00
R5103:Rhpn1 UTSW 15 75714215 missense possibly damaging 0.83
R5121:Rhpn1 UTSW 15 75709260 missense probably damaging 1.00
R5337:Rhpn1 UTSW 15 75708205 missense probably benign
R7324:Rhpn1 UTSW 15 75704397 missense possibly damaging 0.89
R7596:Rhpn1 UTSW 15 75712313 missense probably benign 0.00
R7808:Rhpn1 UTSW 15 75713450 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ATCCTGAGACAGAGGGTCTGGAAC -3'
(R):5'- AGGAATGTACTTGGAAGCCCCAGC -3'

Sequencing Primer
(F):5'- AAGGGGCCAGCTTGTATG -3'
(R):5'- gctgaccttcaactctgtcc -3'
Posted On2014-01-05