Incidental Mutation 'R1052:Olfr414'
ID94008
Institutional Source Beutler Lab
Gene Symbol Olfr414
Ensembl Gene ENSMUSG00000051509
Gene Nameolfactory receptor 414
SynonymsGA_x6K02T2P20D-20749615-20748662, MOR103-10
MMRRC Submission 039142-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R1052 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location174424064-174434747 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 174431135 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 236 (K236*)
Ref Sequence ENSEMBL: ENSMUSP00000142051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053178] [ENSMUST00000192358]
Predicted Effect probably null
Transcript: ENSMUST00000053178
AA Change: K236*
SMART Domains Protein: ENSMUSP00000052426
Gene: ENSMUSG00000051509
AA Change: K236*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.8e-53 PFAM
Pfam:7tm_1 41 290 8.3e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000192358
AA Change: K236*
SMART Domains Protein: ENSMUSP00000142051
Gene: ENSMUSG00000051509
AA Change: K236*

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 2.9e-29 PFAM
Pfam:7tm_4 139 283 1.1e-45 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,705,072 Y528F possibly damaging Het
Acad10 G A 5: 121,649,541 T115I possibly damaging Het
Adam19 T C 11: 46,127,265 F385L probably damaging Het
Adgb T C 10: 10,442,613 N162D probably benign Het
Arhgap20 C A 9: 51,846,270 P521T probably damaging Het
Arsa A T 15: 89,475,177 L134Q probably damaging Het
Atp5b A G 10: 128,090,052 Y508C probably damaging Het
AW554918 G A 18: 25,420,010 M287I probably benign Het
Bmp4 T C 14: 46,383,903 K395E probably damaging Het
Cacna2d4 A G 6: 119,300,333 Y669C probably damaging Het
Casq2 T C 3: 102,144,234 probably null Het
Cdk5rap1 A T 2: 154,360,599 I237N possibly damaging Het
Cerk G C 15: 86,149,364 S286C possibly damaging Het
Cir1 A C 2: 73,287,643 L186R probably damaging Het
Csf3r A T 4: 126,042,988 probably null Het
Cyp3a41a A T 5: 145,705,811 I246K possibly damaging Het
Cyp8b1 A G 9: 121,915,282 F328S possibly damaging Het
Dzank1 A T 2: 144,513,445 V110D probably benign Het
Gm13089 T C 4: 143,696,907 I437M possibly damaging Het
Gm6729 T A 10: 86,540,935 noncoding transcript Het
Gnpat T C 8: 124,877,507 F246L probably benign Het
Gnpat T A 8: 124,878,516 L248H probably damaging Het
Gstm7 T C 3: 107,926,950 T163A probably benign Het
Hspa5 A G 2: 34,775,098 T424A probably damaging Het
Itgb1 T G 8: 128,713,305 D158E probably damaging Het
Kif21a A G 15: 90,935,650 V1637A probably benign Het
Kl G T 5: 150,982,520 V452F probably damaging Het
Krt23 T C 11: 99,478,219 N416S probably benign Het
Lama4 A T 10: 39,092,245 H1461L possibly damaging Het
Lamc3 A G 2: 31,928,802 T1180A probably benign Het
Mboat2 T C 12: 24,946,528 Y145H probably damaging Het
Mlxipl T A 5: 135,113,710 I126N probably damaging Het
Myo16 T A 8: 10,570,181 N1577K possibly damaging Het
Nlrp4f A G 13: 65,185,083 V87A possibly damaging Het
Olfr1039 A G 2: 86,131,571 F31L probably benign Het
Pask A T 1: 93,330,827 D266E probably benign Het
Pcdhb17 A G 18: 37,486,846 Y563C probably damaging Het
Pdlim3 T A 8: 45,896,800 I49N probably damaging Het
Pla2g4c T A 7: 13,343,409 V292E possibly damaging Het
Prrt4 G T 6: 29,169,814 Q880K possibly damaging Het
Pygb A G 2: 150,786,938 D24G probably benign Het
R3hcc1l T A 19: 42,563,654 D363E probably damaging Het
Rif1 A C 2: 52,111,562 Q1676P probably benign Het
Ryr1 C A 7: 29,096,258 R1069L probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc2a13 A G 15: 91,412,160 V317A probably damaging Het
Slc35b4 A T 6: 34,161,684 F197I probably damaging Het
Tchhl1 G A 3: 93,470,213 V75I probably benign Het
Ubr4 T C 4: 139,455,460 S3521P possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp335 GTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTC 2: 164,907,468 probably benign Het
Zfp874a T G 13: 67,442,420 I382L possibly damaging Het
Other mutations in Olfr414
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Olfr414 APN 1 174431342 missense probably benign 0.00
IGL01560:Olfr414 APN 1 174430901 missense probably benign 0.17
IGL01795:Olfr414 APN 1 174430649 missense possibly damaging 0.83
IGL03286:Olfr414 APN 1 174431177 missense probably benign 0.01
PIT4131001:Olfr414 UTSW 1 174430824 missense probably damaging 1.00
R0219:Olfr414 UTSW 1 174430466 missense probably benign 0.00
R0492:Olfr414 UTSW 1 174430563 missense possibly damaging 0.95
R1054:Olfr414 UTSW 1 174430853 missense probably benign 0.36
R1473:Olfr414 UTSW 1 174430643 missense probably damaging 0.97
R1675:Olfr414 UTSW 1 174431097 missense probably benign
R1774:Olfr414 UTSW 1 174431339 missense probably benign 0.00
R1861:Olfr414 UTSW 1 174431091 missense probably damaging 1.00
R1959:Olfr414 UTSW 1 174430905 missense probably damaging 1.00
R1978:Olfr414 UTSW 1 174431091 missense probably damaging 1.00
R4043:Olfr414 UTSW 1 174431091 missense probably damaging 1.00
R5020:Olfr414 UTSW 1 174430671 missense probably damaging 0.98
R5354:Olfr414 UTSW 1 174430686 missense probably damaging 0.98
R5873:Olfr414 UTSW 1 174430782 missense possibly damaging 0.84
R6053:Olfr414 UTSW 1 174430569 nonsense probably null
Z1176:Olfr414 UTSW 1 174430591 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- ACTGCTCAACCTCACTTGTTCAGAC -3'
(R):5'- GCTGGGATCTGCCACACATCAATC -3'

Sequencing Primer
(F):5'- TTGTTCAGACAAGGAACAGGC -3'
(R):5'- AGTACCGTCTTTCTGAAGGCATC -3'
Posted On2014-01-05