Incidental Mutation 'R1052:Hspa5'
ID94010
Institutional Source Beutler Lab
Gene Symbol Hspa5
Ensembl Gene ENSMUSG00000026864
Gene Nameheat shock protein 5
SynonymsBip, 78kDa, Sez7, Grp78, D2Wsu141e, D2Wsu17e, Hsce70, XAP-1 antigen, mBiP, baffled
MMRRC Submission 039142-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1052 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location34771970-34777547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34775098 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 424 (T424A)
Ref Sequence ENSEMBL: ENSMUSP00000097747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028222] [ENSMUST00000100171] [ENSMUST00000113086] [ENSMUST00000118108] [ENSMUST00000137145] [ENSMUST00000145903]
Predicted Effect probably damaging
Transcript: ENSMUST00000028222
AA Change: T424A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028222
Gene: ENSMUSG00000026864
AA Change: T424A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:HSP70 31 637 8.2e-276 PFAM
Pfam:MreB_Mbl 136 406 1.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047963
SMART Domains Protein: ENSMUSP00000037746
Gene: ENSMUSG00000070953

DomainStartEndE-ValueType
Pfam:Kelch_2 5 51 6.7e-13 PFAM
Pfam:Kelch_4 5 58 2e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100171
AA Change: T424A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097747
Gene: ENSMUSG00000026864
AA Change: T424A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:HSP70 31 637 3.3e-278 PFAM
Pfam:MreB_Mbl 136 406 1.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113086
SMART Domains Protein: ENSMUSP00000108709
Gene: ENSMUSG00000070953

DomainStartEndE-ValueType
Pfam:Kelch_2 30 82 5e-15 PFAM
Pfam:Kelch_4 30 86 6.7e-10 PFAM
Pfam:Kelch_3 47 96 1e-12 PFAM
Pfam:Kelch_4 87 140 4.6e-7 PFAM
Pfam:Kelch_3 98 150 1.6e-9 PFAM
Pfam:Kelch_5 138 174 6.2e-8 PFAM
Pfam:Kelch_1 141 186 8.3e-7 PFAM
Pfam:Kelch_4 141 190 2.3e-10 PFAM
Pfam:Kelch_6 141 190 4.1e-10 PFAM
Pfam:Kelch_3 151 200 3.5e-8 PFAM
Pfam:Kelch_5 188 225 1.8e-7 PFAM
Pfam:Kelch_1 191 233 2.8e-9 PFAM
Pfam:Kelch_4 193 240 9.4e-9 PFAM
Pfam:Kelch_3 201 250 6.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118108
SMART Domains Protein: ENSMUSP00000113099
Gene: ENSMUSG00000070953

DomainStartEndE-ValueType
Pfam:Kelch_2 30 82 2.8e-16 PFAM
Pfam:Kelch_4 30 82 3.7e-6 PFAM
Pfam:Kelch_3 99 147 8.2e-9 PFAM
Pfam:Kelch_4 138 191 2.7e-6 PFAM
Pfam:Kelch_3 149 201 7.9e-9 PFAM
Pfam:Kelch_5 189 225 2.8e-7 PFAM
Pfam:Kelch_1 192 237 5.2e-6 PFAM
Pfam:Kelch_4 192 241 1.3e-9 PFAM
Pfam:Kelch_6 192 241 2.4e-9 PFAM
Pfam:Kelch_3 202 251 1.7e-7 PFAM
Pfam:Kelch_5 239 276 8.1e-7 PFAM
Pfam:Kelch_1 242 284 1.8e-8 PFAM
Pfam:Kelch_4 244 291 5.5e-8 PFAM
Pfam:Kelch_3 252 301 3.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129333
Predicted Effect probably benign
Transcript: ENSMUST00000137145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145466
Predicted Effect probably benign
Transcript: ENSMUST00000145903
SMART Domains Protein: ENSMUSP00000122360
Gene: ENSMUSG00000070953

DomainStartEndE-ValueType
Pfam:Kelch_2 38 90 1.5e-17 PFAM
Pfam:Kelch_4 38 90 2.2e-7 PFAM
Pfam:Kelch_1 55 87 4.5e-7 PFAM
Pfam:Kelch_3 107 155 7e-10 PFAM
Pfam:Kelch_4 146 199 4e-7 PFAM
Pfam:Kelch_3 157 209 1.5e-10 PFAM
Pfam:Kelch_5 197 231 1e-8 PFAM
Pfam:Kelch_4 200 249 3.4e-9 PFAM
Pfam:Kelch_5 247 284 5.1e-8 PFAM
Pfam:Kelch_1 250 292 2.9e-9 PFAM
Pfam:Kelch_6 250 301 1.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155595
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the heat shock protein 70 (HSP70) family. It is localized in the lumen of the endoplasmic reticulum (ER), and is involved in the folding and assembly of proteins in the ER. As this protein interacts with many ER proteins, it may play a key role in monitoring protein transport through the cell.[provided by RefSeq, Sep 2010]
PHENOTYPE: Nullizygous embryos die around implantation. Neonates homozygous for a knock-in allele die of respiratory failure. Mice homozygous for an ENU-induced mutation exhibit abnormal thalamocortical axon patterning, small kidneys, cleft palate, respiratory distress, and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,705,072 Y528F possibly damaging Het
Acad10 G A 5: 121,649,541 T115I possibly damaging Het
Adam19 T C 11: 46,127,265 F385L probably damaging Het
Adgb T C 10: 10,442,613 N162D probably benign Het
Arhgap20 C A 9: 51,846,270 P521T probably damaging Het
Arsa A T 15: 89,475,177 L134Q probably damaging Het
Atp5b A G 10: 128,090,052 Y508C probably damaging Het
AW554918 G A 18: 25,420,010 M287I probably benign Het
Bmp4 T C 14: 46,383,903 K395E probably damaging Het
Cacna2d4 A G 6: 119,300,333 Y669C probably damaging Het
Casq2 T C 3: 102,144,234 probably null Het
Cdk5rap1 A T 2: 154,360,599 I237N possibly damaging Het
Cerk G C 15: 86,149,364 S286C possibly damaging Het
Cir1 A C 2: 73,287,643 L186R probably damaging Het
Csf3r A T 4: 126,042,988 probably null Het
Cyp3a41a A T 5: 145,705,811 I246K possibly damaging Het
Cyp8b1 A G 9: 121,915,282 F328S possibly damaging Het
Dzank1 A T 2: 144,513,445 V110D probably benign Het
Gm13089 T C 4: 143,696,907 I437M possibly damaging Het
Gm6729 T A 10: 86,540,935 noncoding transcript Het
Gnpat T C 8: 124,877,507 F246L probably benign Het
Gnpat T A 8: 124,878,516 L248H probably damaging Het
Gstm7 T C 3: 107,926,950 T163A probably benign Het
Itgb1 T G 8: 128,713,305 D158E probably damaging Het
Kif21a A G 15: 90,935,650 V1637A probably benign Het
Kl G T 5: 150,982,520 V452F probably damaging Het
Krt23 T C 11: 99,478,219 N416S probably benign Het
Lama4 A T 10: 39,092,245 H1461L possibly damaging Het
Lamc3 A G 2: 31,928,802 T1180A probably benign Het
Mboat2 T C 12: 24,946,528 Y145H probably damaging Het
Mlxipl T A 5: 135,113,710 I126N probably damaging Het
Myo16 T A 8: 10,570,181 N1577K possibly damaging Het
Nlrp4f A G 13: 65,185,083 V87A possibly damaging Het
Olfr1039 A G 2: 86,131,571 F31L probably benign Het
Olfr414 A T 1: 174,431,135 K236* probably null Het
Pask A T 1: 93,330,827 D266E probably benign Het
Pcdhb17 A G 18: 37,486,846 Y563C probably damaging Het
Pdlim3 T A 8: 45,896,800 I49N probably damaging Het
Pla2g4c T A 7: 13,343,409 V292E possibly damaging Het
Prrt4 G T 6: 29,169,814 Q880K possibly damaging Het
Pygb A G 2: 150,786,938 D24G probably benign Het
R3hcc1l T A 19: 42,563,654 D363E probably damaging Het
Rif1 A C 2: 52,111,562 Q1676P probably benign Het
Ryr1 C A 7: 29,096,258 R1069L probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc2a13 A G 15: 91,412,160 V317A probably damaging Het
Slc35b4 A T 6: 34,161,684 F197I probably damaging Het
Tchhl1 G A 3: 93,470,213 V75I probably benign Het
Ubr4 T C 4: 139,455,460 S3521P possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp335 GTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTC 2: 164,907,468 probably benign Het
Zfp874a T G 13: 67,442,420 I382L possibly damaging Het
Other mutations in Hspa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:Hspa5 APN 2 34774718 missense probably benign
IGL01997:Hspa5 APN 2 34772315 utr 5 prime probably benign
IGL02239:Hspa5 APN 2 34772776 missense probably benign 0.00
IGL03326:Hspa5 APN 2 34776117 unclassified probably benign
R0281:Hspa5 UTSW 2 34774320 missense probably damaging 1.00
R1687:Hspa5 UTSW 2 34775824 missense probably benign 0.00
R1741:Hspa5 UTSW 2 34772692 missense possibly damaging 0.91
R1833:Hspa5 UTSW 2 34776053 nonsense probably null
R1842:Hspa5 UTSW 2 34775803 missense probably damaging 1.00
R1851:Hspa5 UTSW 2 34774678 missense possibly damaging 0.64
R1864:Hspa5 UTSW 2 34774541 missense probably damaging 0.99
R1865:Hspa5 UTSW 2 34774541 missense probably damaging 0.99
R2173:Hspa5 UTSW 2 34774662 missense probably damaging 1.00
R5027:Hspa5 UTSW 2 34775815 missense probably damaging 1.00
R5889:Hspa5 UTSW 2 34774617 missense probably damaging 1.00
R6046:Hspa5 UTSW 2 34775749 missense possibly damaging 0.94
R6515:Hspa5 UTSW 2 34772404 missense probably benign 0.05
R7045:Hspa5 UTSW 2 34773192 missense probably damaging 0.99
R7046:Hspa5 UTSW 2 34773192 missense probably damaging 0.99
R7047:Hspa5 UTSW 2 34773192 missense probably damaging 0.99
R7049:Hspa5 UTSW 2 34773192 missense probably damaging 0.99
R7185:Hspa5 UTSW 2 34775126 missense probably damaging 1.00
R7238:Hspa5 UTSW 2 34772371 missense unknown
R7879:Hspa5 UTSW 2 34775929 missense probably benign 0.05
X0067:Hspa5 UTSW 2 34775101 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGAGCCATCCCGTGGCATAAAC -3'
(R):5'- CAAAGCATTGTAAGCCCCTCTGACC -3'

Sequencing Primer
(F):5'- CCTCTCTGGTGATCAGGATACAG -3'
(R):5'- taatattGTGAAACCCAGATCACATC -3'
Posted On2014-01-05