Incidental Mutation 'R1052:Abtb2'
ID94017
Institutional Source Beutler Lab
Gene Symbol Abtb2
Ensembl Gene ENSMUSG00000032724
Gene Nameankyrin repeat and BTB (POZ) domain containing 2
Synonyms
MMRRC Submission 039142-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1052 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location103566310-103718423 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103705072 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 528 (Y528F)
Ref Sequence ENSEMBL: ENSMUSP00000075566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076212]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076212
AA Change: Y528F

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724
AA Change: Y528F

DomainStartEndE-ValueType
low complexity region 29 48 N/A INTRINSIC
low complexity region 122 143 N/A INTRINSIC
Blast:H2A 186 301 2e-38 BLAST
low complexity region 366 376 N/A INTRINSIC
ANK 521 550 4.78e-7 SMART
ANK 567 596 6.26e-2 SMART
ANK 606 635 3.65e-3 SMART
ANK 649 678 5.52e2 SMART
ANK 715 746 1.84e3 SMART
BTB 844 946 9.15e-24 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 G A 5: 121,649,541 T115I possibly damaging Het
Adam19 T C 11: 46,127,265 F385L probably damaging Het
Adgb T C 10: 10,442,613 N162D probably benign Het
Arhgap20 C A 9: 51,846,270 P521T probably damaging Het
Arsa A T 15: 89,475,177 L134Q probably damaging Het
Atp5b A G 10: 128,090,052 Y508C probably damaging Het
AW554918 G A 18: 25,420,010 M287I probably benign Het
Bmp4 T C 14: 46,383,903 K395E probably damaging Het
Cacna2d4 A G 6: 119,300,333 Y669C probably damaging Het
Casq2 T C 3: 102,144,234 probably null Het
Cdk5rap1 A T 2: 154,360,599 I237N possibly damaging Het
Cerk G C 15: 86,149,364 S286C possibly damaging Het
Cir1 A C 2: 73,287,643 L186R probably damaging Het
Csf3r A T 4: 126,042,988 probably null Het
Cyp3a41a A T 5: 145,705,811 I246K possibly damaging Het
Cyp8b1 A G 9: 121,915,282 F328S possibly damaging Het
Dzank1 A T 2: 144,513,445 V110D probably benign Het
Gm13089 T C 4: 143,696,907 I437M possibly damaging Het
Gm6729 T A 10: 86,540,935 noncoding transcript Het
Gnpat T C 8: 124,877,507 F246L probably benign Het
Gnpat T A 8: 124,878,516 L248H probably damaging Het
Gstm7 T C 3: 107,926,950 T163A probably benign Het
Hspa5 A G 2: 34,775,098 T424A probably damaging Het
Itgb1 T G 8: 128,713,305 D158E probably damaging Het
Kif21a A G 15: 90,935,650 V1637A probably benign Het
Kl G T 5: 150,982,520 V452F probably damaging Het
Krt23 T C 11: 99,478,219 N416S probably benign Het
Lama4 A T 10: 39,092,245 H1461L possibly damaging Het
Lamc3 A G 2: 31,928,802 T1180A probably benign Het
Mboat2 T C 12: 24,946,528 Y145H probably damaging Het
Mlxipl T A 5: 135,113,710 I126N probably damaging Het
Myo16 T A 8: 10,570,181 N1577K possibly damaging Het
Nlrp4f A G 13: 65,185,083 V87A possibly damaging Het
Olfr1039 A G 2: 86,131,571 F31L probably benign Het
Olfr414 A T 1: 174,431,135 K236* probably null Het
Pask A T 1: 93,330,827 D266E probably benign Het
Pcdhb17 A G 18: 37,486,846 Y563C probably damaging Het
Pdlim3 T A 8: 45,896,800 I49N probably damaging Het
Pla2g4c T A 7: 13,343,409 V292E possibly damaging Het
Prrt4 G T 6: 29,169,814 Q880K possibly damaging Het
Pygb A G 2: 150,786,938 D24G probably benign Het
R3hcc1l T A 19: 42,563,654 D363E probably damaging Het
Rif1 A C 2: 52,111,562 Q1676P probably benign Het
Ryr1 C A 7: 29,096,258 R1069L probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc2a13 A G 15: 91,412,160 V317A probably damaging Het
Slc35b4 A T 6: 34,161,684 F197I probably damaging Het
Tchhl1 G A 3: 93,470,213 V75I probably benign Het
Ubr4 T C 4: 139,455,460 S3521P possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp335 GTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTC 2: 164,907,468 probably benign Het
Zfp874a T G 13: 67,442,420 I382L possibly damaging Het
Other mutations in Abtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Abtb2 APN 2 103705118 missense probably benign 0.00
IGL02605:Abtb2 APN 2 103717257 missense probably benign
IGL03161:Abtb2 APN 2 103567454 missense probably benign 0.02
PIT4504001:Abtb2 UTSW 2 103717192 nonsense probably null
R0147:Abtb2 UTSW 2 103567135 missense probably benign 0.04
R1419:Abtb2 UTSW 2 103709420 missense probably benign 0.00
R1518:Abtb2 UTSW 2 103709284 missense probably benign 0.03
R1650:Abtb2 UTSW 2 103702402 missense probably damaging 1.00
R1795:Abtb2 UTSW 2 103567024 missense probably benign 0.00
R2054:Abtb2 UTSW 2 103705117 missense probably benign 0.41
R2101:Abtb2 UTSW 2 103566862 missense probably benign 0.05
R2363:Abtb2 UTSW 2 103567183 missense probably damaging 1.00
R3440:Abtb2 UTSW 2 103567232 missense probably benign 0.43
R3927:Abtb2 UTSW 2 103708218 splice site probably null
R4351:Abtb2 UTSW 2 103683393 missense possibly damaging 0.46
R4352:Abtb2 UTSW 2 103683393 missense possibly damaging 0.46
R4782:Abtb2 UTSW 2 103717299 missense probably benign 0.35
R4814:Abtb2 UTSW 2 103717287 missense probably benign 0.08
R4831:Abtb2 UTSW 2 103683475 missense probably benign 0.06
R4900:Abtb2 UTSW 2 103567004 missense possibly damaging 0.62
R5038:Abtb2 UTSW 2 103567063 missense probably damaging 0.99
R5513:Abtb2 UTSW 2 103709278 critical splice acceptor site probably null
R6119:Abtb2 UTSW 2 103702310 missense probably benign 0.00
R6298:Abtb2 UTSW 2 103709488 missense probably benign 0.10
R6383:Abtb2 UTSW 2 103567376 missense probably damaging 0.98
R6860:Abtb2 UTSW 2 103709425 nonsense probably null
R7000:Abtb2 UTSW 2 103712442 missense possibly damaging 0.85
R7109:Abtb2 UTSW 2 103715515 missense probably benign 0.20
R7176:Abtb2 UTSW 2 103709375 missense probably benign 0.00
R7189:Abtb2 UTSW 2 103567516 missense probably benign 0.00
R7199:Abtb2 UTSW 2 103567220 missense possibly damaging 0.74
R7299:Abtb2 UTSW 2 103702424 splice site probably null
R7347:Abtb2 UTSW 2 103567412 missense probably damaging 1.00
R7469:Abtb2 UTSW 2 103566947 missense probably benign 0.00
R7629:Abtb2 UTSW 2 103683493 critical splice donor site probably null
R7862:Abtb2 UTSW 2 103702281 missense probably damaging 1.00
R7945:Abtb2 UTSW 2 103702281 missense probably damaging 1.00
R8200:Abtb2 UTSW 2 103700817 missense probably benign 0.02
Z1176:Abtb2 UTSW 2 103708172 nonsense probably null
Z1177:Abtb2 UTSW 2 103711196 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACACTGCTGAGCACAAGCTTC -3'
(R):5'- AGTTTAAATACCACGCCCAGCCTG -3'

Sequencing Primer
(F):5'- caatgaggataacaatagaagccac -3'
(R):5'- CTGGCTGCTGGAGATCG -3'
Posted On2014-01-05