Incidental Mutation 'R1052:Dzank1'
ID94020
Institutional Source Beutler Lab
Gene Symbol Dzank1
Ensembl Gene ENSMUSG00000037259
Gene Namedouble zinc ribbon and ankyrin repeat domains 1
Synonyms2810039F03Rik, 6330439K17Rik, Ankrd64
MMRRC Submission 039142-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1052 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location144470557-144527414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 144513445 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 110 (V110D)
Ref Sequence ENSEMBL: ENSMUSP00000133177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081982] [ENSMUST00000163701]
Predicted Effect probably benign
Transcript: ENSMUST00000081982
AA Change: V110D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080643
Gene: ENSMUSG00000037259
AA Change: V110D

DomainStartEndE-ValueType
Pfam:CHB_HEX_C 11 99 1.1e-16 PFAM
Pfam:CHB_HEX_C_1 20 97 4.5e-18 PFAM
Pfam:Fn3_assoc 32 100 1.6e-17 PFAM
ZnF_RBZ 268 292 5.44e0 SMART
ZnF_RBZ 307 331 2.55e0 SMART
Blast:ZnF_RBZ 355 378 1e-7 BLAST
ZnF_RBZ 385 409 3.13e0 SMART
low complexity region 591 604 N/A INTRINSIC
ANK 631 662 2.97e2 SMART
ANK 666 695 2.83e0 SMART
Blast:ANK 700 731 7e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124823
Predicted Effect probably benign
Transcript: ENSMUST00000163701
AA Change: V110D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133177
Gene: ENSMUSG00000037259
AA Change: V110D

DomainStartEndE-ValueType
Pfam:CHB_HEX_C 12 99 1.5e-17 PFAM
Pfam:CHB_HEX_C_1 21 97 8.5e-17 PFAM
Pfam:Fn3_assoc 32 100 3.7e-18 PFAM
ZnF_RBZ 269 293 5.44e0 SMART
ZnF_RBZ 308 332 2.55e0 SMART
Blast:ZnF_RBZ 356 379 1e-7 BLAST
ZnF_RBZ 386 410 3.13e0 SMART
low complexity region 592 605 N/A INTRINSIC
ANK 632 663 2.97e2 SMART
ANK 667 696 2.83e0 SMART
Blast:ANK 701 732 7e-12 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains two ankyrin repeat-encoding regions. Ankyrin repeats are tandemly repeated modules of about 33 amino acids described as L-shaped structures consisting of a beta-hairpin and two alpha-helices. Ankyrin repeats occur in a large number of functionally diverse proteins, mainly from eukaryotes, and are known to function as protein-protein interaction domains. Alternative splicing has been observed for this gene but the full-length nature of additional variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,705,072 Y528F possibly damaging Het
Acad10 G A 5: 121,649,541 T115I possibly damaging Het
Adam19 T C 11: 46,127,265 F385L probably damaging Het
Adgb T C 10: 10,442,613 N162D probably benign Het
Arhgap20 C A 9: 51,846,270 P521T probably damaging Het
Arsa A T 15: 89,475,177 L134Q probably damaging Het
Atp5b A G 10: 128,090,052 Y508C probably damaging Het
AW554918 G A 18: 25,420,010 M287I probably benign Het
Bmp4 T C 14: 46,383,903 K395E probably damaging Het
Cacna2d4 A G 6: 119,300,333 Y669C probably damaging Het
Casq2 T C 3: 102,144,234 probably null Het
Cdk5rap1 A T 2: 154,360,599 I237N possibly damaging Het
Cerk G C 15: 86,149,364 S286C possibly damaging Het
Cir1 A C 2: 73,287,643 L186R probably damaging Het
Csf3r A T 4: 126,042,988 probably null Het
Cyp3a41a A T 5: 145,705,811 I246K possibly damaging Het
Cyp8b1 A G 9: 121,915,282 F328S possibly damaging Het
Gm13089 T C 4: 143,696,907 I437M possibly damaging Het
Gm6729 T A 10: 86,540,935 noncoding transcript Het
Gnpat T C 8: 124,877,507 F246L probably benign Het
Gnpat T A 8: 124,878,516 L248H probably damaging Het
Gstm7 T C 3: 107,926,950 T163A probably benign Het
Hspa5 A G 2: 34,775,098 T424A probably damaging Het
Itgb1 T G 8: 128,713,305 D158E probably damaging Het
Kif21a A G 15: 90,935,650 V1637A probably benign Het
Kl G T 5: 150,982,520 V452F probably damaging Het
Krt23 T C 11: 99,478,219 N416S probably benign Het
Lama4 A T 10: 39,092,245 H1461L possibly damaging Het
Lamc3 A G 2: 31,928,802 T1180A probably benign Het
Mboat2 T C 12: 24,946,528 Y145H probably damaging Het
Mlxipl T A 5: 135,113,710 I126N probably damaging Het
Myo16 T A 8: 10,570,181 N1577K possibly damaging Het
Nlrp4f A G 13: 65,185,083 V87A possibly damaging Het
Olfr1039 A G 2: 86,131,571 F31L probably benign Het
Olfr414 A T 1: 174,431,135 K236* probably null Het
Pask A T 1: 93,330,827 D266E probably benign Het
Pcdhb17 A G 18: 37,486,846 Y563C probably damaging Het
Pdlim3 T A 8: 45,896,800 I49N probably damaging Het
Pla2g4c T A 7: 13,343,409 V292E possibly damaging Het
Prrt4 G T 6: 29,169,814 Q880K possibly damaging Het
Pygb A G 2: 150,786,938 D24G probably benign Het
R3hcc1l T A 19: 42,563,654 D363E probably damaging Het
Rif1 A C 2: 52,111,562 Q1676P probably benign Het
Ryr1 C A 7: 29,096,258 R1069L probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc2a13 A G 15: 91,412,160 V317A probably damaging Het
Slc35b4 A T 6: 34,161,684 F197I probably damaging Het
Tchhl1 G A 3: 93,470,213 V75I probably benign Het
Ubr4 T C 4: 139,455,460 S3521P possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp335 GTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTC 2: 164,907,468 probably benign Het
Zfp874a T G 13: 67,442,420 I382L possibly damaging Het
Other mutations in Dzank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Dzank1 APN 2 144481725 nonsense probably null
IGL00955:Dzank1 APN 2 144490174 missense probably benign 0.22
IGL01888:Dzank1 APN 2 144476154 splice site probably null
IGL02108:Dzank1 APN 2 144506223 missense probably benign 0.02
IGL02979:Dzank1 APN 2 144488738 missense probably damaging 1.00
BB008:Dzank1 UTSW 2 144481694 missense not run
BB018:Dzank1 UTSW 2 144481694 missense not run
PIT4466001:Dzank1 UTSW 2 144483373 missense probably benign 0.00
R0388:Dzank1 UTSW 2 144476106 missense possibly damaging 0.86
R0603:Dzank1 UTSW 2 144511512 missense probably benign 0.04
R1386:Dzank1 UTSW 2 144491831 missense probably benign 0.05
R1529:Dzank1 UTSW 2 144482188 missense probably benign 0.01
R1634:Dzank1 UTSW 2 144481669 missense probably benign 0.01
R2761:Dzank1 UTSW 2 144513449 missense probably benign
R4024:Dzank1 UTSW 2 144482227 missense probably benign
R4279:Dzank1 UTSW 2 144491845 missense probably benign 0.00
R4324:Dzank1 UTSW 2 144488698 missense possibly damaging 0.95
R4516:Dzank1 UTSW 2 144510122 intron probably benign
R4713:Dzank1 UTSW 2 144491804 missense probably benign 0.13
R4782:Dzank1 UTSW 2 144504399 missense probably damaging 1.00
R4994:Dzank1 UTSW 2 144522566 missense probably damaging 1.00
R5157:Dzank1 UTSW 2 144483412 missense probably damaging 0.98
R5514:Dzank1 UTSW 2 144481685 missense probably benign 0.01
R5580:Dzank1 UTSW 2 144506178 missense probably damaging 1.00
R5635:Dzank1 UTSW 2 144483407 missense probably damaging 1.00
R5793:Dzank1 UTSW 2 144506224 missense probably benign 0.14
R5820:Dzank1 UTSW 2 144513488 missense probably damaging 1.00
R5976:Dzank1 UTSW 2 144501489 missense probably damaging 1.00
R6935:Dzank1 UTSW 2 144476094 missense possibly damaging 0.64
R6980:Dzank1 UTSW 2 144490136 missense possibly damaging 0.87
R7331:Dzank1 UTSW 2 144490270 missense probably benign 0.17
R7691:Dzank1 UTSW 2 144506171 missense probably damaging 1.00
R7814:Dzank1 UTSW 2 144522564 missense probably damaging 1.00
R7879:Dzank1 UTSW 2 144491798 missense probably benign 0.01
R7962:Dzank1 UTSW 2 144491798 missense probably benign 0.01
R8127:Dzank1 UTSW 2 144488816 missense probably damaging 1.00
R8192:Dzank1 UTSW 2 144490225 missense probably benign 0.05
R8314:Dzank1 UTSW 2 144502958 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTCTTGGGTGGCAGCCTAATG -3'
(R):5'- AGCTCCTTAGAGCTGAGGCCAATAC -3'

Sequencing Primer
(F):5'- CTGGTCTTAGAAGAAGGCTTAACC -3'
(R):5'- AGCCATTGCTGAAAGCTGTC -3'
Posted On2014-01-05