Incidental Mutation 'R1052:Pygb'
ID94021
Institutional Source Beutler Lab
Gene Symbol Pygb
Ensembl Gene ENSMUSG00000033059
Gene Namebrain glycogen phosphorylase
Synonyms
MMRRC Submission 039142-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R1052 (G1)
Quality Score95
Status Not validated
Chromosome2
Chromosomal Location150786735-150831758 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 150786938 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 24 (D24G)
Ref Sequence ENSEMBL: ENSMUSP00000035743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045441]
Predicted Effect probably benign
Transcript: ENSMUST00000045441
AA Change: D24G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000035743
Gene: ENSMUSG00000033059
AA Change: D24G

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139938
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycogen phosphorylase found predominantly in the brain. The encoded protein forms homodimers which can associate into homotetramers, the enzymatically active form of glycogen phosphorylase. The activity of this enzyme is positively regulated by AMP and negatively regulated by ATP, ADP, and glucose-6-phosphate. This enzyme catalyzes the rate-determining step in glycogen degradation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,705,072 Y528F possibly damaging Het
Acad10 G A 5: 121,649,541 T115I possibly damaging Het
Adam19 T C 11: 46,127,265 F385L probably damaging Het
Adgb T C 10: 10,442,613 N162D probably benign Het
Arhgap20 C A 9: 51,846,270 P521T probably damaging Het
Arsa A T 15: 89,475,177 L134Q probably damaging Het
Atp5b A G 10: 128,090,052 Y508C probably damaging Het
AW554918 G A 18: 25,420,010 M287I probably benign Het
Bmp4 T C 14: 46,383,903 K395E probably damaging Het
Cacna2d4 A G 6: 119,300,333 Y669C probably damaging Het
Casq2 T C 3: 102,144,234 probably null Het
Cdk5rap1 A T 2: 154,360,599 I237N possibly damaging Het
Cerk G C 15: 86,149,364 S286C possibly damaging Het
Cir1 A C 2: 73,287,643 L186R probably damaging Het
Csf3r A T 4: 126,042,988 probably null Het
Cyp3a41a A T 5: 145,705,811 I246K possibly damaging Het
Cyp8b1 A G 9: 121,915,282 F328S possibly damaging Het
Dzank1 A T 2: 144,513,445 V110D probably benign Het
Gm13089 T C 4: 143,696,907 I437M possibly damaging Het
Gm6729 T A 10: 86,540,935 noncoding transcript Het
Gnpat T C 8: 124,877,507 F246L probably benign Het
Gnpat T A 8: 124,878,516 L248H probably damaging Het
Gstm7 T C 3: 107,926,950 T163A probably benign Het
Hspa5 A G 2: 34,775,098 T424A probably damaging Het
Itgb1 T G 8: 128,713,305 D158E probably damaging Het
Kif21a A G 15: 90,935,650 V1637A probably benign Het
Kl G T 5: 150,982,520 V452F probably damaging Het
Krt23 T C 11: 99,478,219 N416S probably benign Het
Lama4 A T 10: 39,092,245 H1461L possibly damaging Het
Lamc3 A G 2: 31,928,802 T1180A probably benign Het
Mboat2 T C 12: 24,946,528 Y145H probably damaging Het
Mlxipl T A 5: 135,113,710 I126N probably damaging Het
Myo16 T A 8: 10,570,181 N1577K possibly damaging Het
Nlrp4f A G 13: 65,185,083 V87A possibly damaging Het
Olfr1039 A G 2: 86,131,571 F31L probably benign Het
Olfr414 A T 1: 174,431,135 K236* probably null Het
Pask A T 1: 93,330,827 D266E probably benign Het
Pcdhb17 A G 18: 37,486,846 Y563C probably damaging Het
Pdlim3 T A 8: 45,896,800 I49N probably damaging Het
Pla2g4c T A 7: 13,343,409 V292E possibly damaging Het
Prrt4 G T 6: 29,169,814 Q880K possibly damaging Het
R3hcc1l T A 19: 42,563,654 D363E probably damaging Het
Rif1 A C 2: 52,111,562 Q1676P probably benign Het
Ryr1 C A 7: 29,096,258 R1069L probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc2a13 A G 15: 91,412,160 V317A probably damaging Het
Slc35b4 A T 6: 34,161,684 F197I probably damaging Het
Tchhl1 G A 3: 93,470,213 V75I probably benign Het
Ubr4 T C 4: 139,455,460 S3521P possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp335 GTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTC 2: 164,907,468 probably benign Het
Zfp874a T G 13: 67,442,420 I382L possibly damaging Het
Other mutations in Pygb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Pygb APN 2 150819913 missense probably benign 0.00
IGL01395:Pygb APN 2 150801583 missense probably benign 0.04
IGL01571:Pygb APN 2 150830473 missense probably benign 0.00
IGL01960:Pygb APN 2 150813483 missense probably benign 0.00
IGL03118:Pygb APN 2 150820811 missense probably benign 0.01
R0106:Pygb UTSW 2 150806203 missense probably benign 0.02
R0106:Pygb UTSW 2 150806203 missense probably benign 0.02
R0423:Pygb UTSW 2 150823984 missense probably benign
R0545:Pygb UTSW 2 150815706 missense probably benign 0.00
R0674:Pygb UTSW 2 150815134 splice site probably null
R1590:Pygb UTSW 2 150817663 missense possibly damaging 0.94
R1706:Pygb UTSW 2 150827147 missense probably damaging 1.00
R1786:Pygb UTSW 2 150816772 missense probably damaging 0.98
R2405:Pygb UTSW 2 150820775 missense probably benign 0.04
R3522:Pygb UTSW 2 150828553 missense probably benign 0.07
R4082:Pygb UTSW 2 150826471 critical splice donor site probably null
R4319:Pygb UTSW 2 150815614 splice site probably benign
R4662:Pygb UTSW 2 150815116 missense probably benign
R5072:Pygb UTSW 2 150801578 missense probably damaging 1.00
R5665:Pygb UTSW 2 150820888 splice site probably null
R5874:Pygb UTSW 2 150786878 missense probably benign 0.11
R5910:Pygb UTSW 2 150815700 missense probably benign 0.00
R6610:Pygb UTSW 2 150823966 splice site probably null
R6820:Pygb UTSW 2 150816754 missense possibly damaging 0.88
R7348:Pygb UTSW 2 150786983 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ACGTTCTCTTCCCGGCTGAAAC -3'
(R):5'- TCCCGCTCATAGTAATGCTGCTGC -3'

Sequencing Primer
(F):5'- GCTGAAACAGCCTGATTGAC -3'
(R):5'- TGTGCCAGAGCGAAGAAGTA -3'
Posted On2014-01-05