Incidental Mutation 'R1052:Acad10'
ID94036
Institutional Source Beutler Lab
Gene Symbol Acad10
Ensembl Gene ENSMUSG00000029456
Gene Nameacyl-Coenzyme A dehydrogenase family, member 10
Synonyms2410021P16Rik
MMRRC Submission 039142-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1052 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location121621026-121660514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121649541 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 115 (T115I)
Ref Sequence ENSEMBL: ENSMUSP00000107400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031412] [ENSMUST00000111770]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031412
AA Change: T115I

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031412
Gene: ENSMUSG00000029456
AA Change: T115I

DomainStartEndE-ValueType
Pfam:HAD_2 45 231 1.6e-14 PFAM
Pfam:Hydrolase 88 225 5e-8 PFAM
Pfam:APH 287 531 1.8e-52 PFAM
Pfam:Acyl-CoA_dh_N 660 787 1.7e-15 PFAM
Pfam:Acyl-CoA_dh_M 791 892 2.7e-20 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 1.1e-35 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 6.4e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111770
AA Change: T115I

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107400
Gene: ENSMUSG00000029456
AA Change: T115I

DomainStartEndE-ValueType
Pfam:HAD_2 45 231 2.3e-14 PFAM
Pfam:APH 287 523 3.2e-50 PFAM
Pfam:EcKinase 390 504 5.2e-8 PFAM
Pfam:Acyl-CoA_dh_N 660 787 3.4e-14 PFAM
Pfam:Acyl-CoA_dh_M 791 845 2.7e-13 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 9.4e-36 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 1.6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137231
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA dehydrogenase family of enzymes (ACADs), which participate in the beta-oxidation of fatty acids in mitochondria. The encoded enzyme contains a hydrolase domain at the N-terminal portion, a serine/threonine protein kinase catlytic domain in the central region, and a conserved ACAD domain at the C-terminus. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,705,072 Y528F possibly damaging Het
Adam19 T C 11: 46,127,265 F385L probably damaging Het
Adgb T C 10: 10,442,613 N162D probably benign Het
Arhgap20 C A 9: 51,846,270 P521T probably damaging Het
Arsa A T 15: 89,475,177 L134Q probably damaging Het
Atp5b A G 10: 128,090,052 Y508C probably damaging Het
AW554918 G A 18: 25,420,010 M287I probably benign Het
Bmp4 T C 14: 46,383,903 K395E probably damaging Het
Cacna2d4 A G 6: 119,300,333 Y669C probably damaging Het
Casq2 T C 3: 102,144,234 probably null Het
Cdk5rap1 A T 2: 154,360,599 I237N possibly damaging Het
Cerk G C 15: 86,149,364 S286C possibly damaging Het
Cir1 A C 2: 73,287,643 L186R probably damaging Het
Csf3r A T 4: 126,042,988 probably null Het
Cyp3a41a A T 5: 145,705,811 I246K possibly damaging Het
Cyp8b1 A G 9: 121,915,282 F328S possibly damaging Het
Dzank1 A T 2: 144,513,445 V110D probably benign Het
Gm13089 T C 4: 143,696,907 I437M possibly damaging Het
Gm6729 T A 10: 86,540,935 noncoding transcript Het
Gnpat T C 8: 124,877,507 F246L probably benign Het
Gnpat T A 8: 124,878,516 L248H probably damaging Het
Gstm7 T C 3: 107,926,950 T163A probably benign Het
Hspa5 A G 2: 34,775,098 T424A probably damaging Het
Itgb1 T G 8: 128,713,305 D158E probably damaging Het
Kif21a A G 15: 90,935,650 V1637A probably benign Het
Kl G T 5: 150,982,520 V452F probably damaging Het
Krt23 T C 11: 99,478,219 N416S probably benign Het
Lama4 A T 10: 39,092,245 H1461L possibly damaging Het
Lamc3 A G 2: 31,928,802 T1180A probably benign Het
Mboat2 T C 12: 24,946,528 Y145H probably damaging Het
Mlxipl T A 5: 135,113,710 I126N probably damaging Het
Myo16 T A 8: 10,570,181 N1577K possibly damaging Het
Nlrp4f A G 13: 65,185,083 V87A possibly damaging Het
Olfr1039 A G 2: 86,131,571 F31L probably benign Het
Olfr414 A T 1: 174,431,135 K236* probably null Het
Pask A T 1: 93,330,827 D266E probably benign Het
Pcdhb17 A G 18: 37,486,846 Y563C probably damaging Het
Pdlim3 T A 8: 45,896,800 I49N probably damaging Het
Pla2g4c T A 7: 13,343,409 V292E possibly damaging Het
Prrt4 G T 6: 29,169,814 Q880K possibly damaging Het
Pygb A G 2: 150,786,938 D24G probably benign Het
R3hcc1l T A 19: 42,563,654 D363E probably damaging Het
Rif1 A C 2: 52,111,562 Q1676P probably benign Het
Ryr1 C A 7: 29,096,258 R1069L probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc2a13 A G 15: 91,412,160 V317A probably damaging Het
Slc35b4 A T 6: 34,161,684 F197I probably damaging Het
Tchhl1 G A 3: 93,470,213 V75I probably benign Het
Ubr4 T C 4: 139,455,460 S3521P possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp335 GTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTC 2: 164,907,468 probably benign Het
Zfp874a T G 13: 67,442,420 I382L possibly damaging Het
Other mutations in Acad10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02379:Acad10 APN 5 121622043 missense probably damaging 1.00
IGL02469:Acad10 APN 5 121645459 missense probably damaging 1.00
IGL02526:Acad10 APN 5 121646860 missense probably damaging 0.99
IGL02623:Acad10 APN 5 121629930 missense possibly damaging 0.94
IGL02643:Acad10 APN 5 121631570 missense probably benign
IGL02685:Acad10 APN 5 121632609 missense probably benign
IGL03139:Acad10 APN 5 121626082 missense probably benign
IGL03267:Acad10 APN 5 121637349 missense probably benign 0.34
P0026:Acad10 UTSW 5 121637352 missense probably damaging 1.00
R0099:Acad10 UTSW 5 121621290 missense probably damaging 1.00
R0453:Acad10 UTSW 5 121627382 nonsense probably null
R1051:Acad10 UTSW 5 121626080 missense probably damaging 0.97
R1116:Acad10 UTSW 5 121630751 missense probably damaging 1.00
R1548:Acad10 UTSW 5 121626040 splice site probably benign
R1548:Acad10 UTSW 5 121626041 splice site probably benign
R1571:Acad10 UTSW 5 121621348 missense probably damaging 0.99
R1592:Acad10 UTSW 5 121645381 missense probably damaging 0.99
R1741:Acad10 UTSW 5 121647836 missense probably damaging 1.00
R1789:Acad10 UTSW 5 121631393 missense possibly damaging 0.67
R1974:Acad10 UTSW 5 121626185 missense possibly damaging 0.95
R2007:Acad10 UTSW 5 121634751 missense probably damaging 1.00
R2085:Acad10 UTSW 5 121649460 missense possibly damaging 0.79
R2351:Acad10 UTSW 5 121629927 missense probably benign 0.23
R2511:Acad10 UTSW 5 121631567 missense probably benign 0.02
R2570:Acad10 UTSW 5 121630204 missense probably damaging 1.00
R3824:Acad10 UTSW 5 121622818 missense probably benign
R3846:Acad10 UTSW 5 121634686 missense probably benign 0.19
R4106:Acad10 UTSW 5 121631464 missense probably damaging 0.98
R4107:Acad10 UTSW 5 121631464 missense probably damaging 0.98
R4108:Acad10 UTSW 5 121631464 missense probably damaging 0.98
R5569:Acad10 UTSW 5 121626080 missense probably damaging 0.97
R5704:Acad10 UTSW 5 121631543 missense probably benign 0.03
R5845:Acad10 UTSW 5 121626083 missense probably benign
R5990:Acad10 UTSW 5 121645405 missense probably damaging 1.00
R6019:Acad10 UTSW 5 121634801 missense possibly damaging 0.88
R6145:Acad10 UTSW 5 121622033 missense probably damaging 0.97
R6384:Acad10 UTSW 5 121652003 missense probably benign 0.43
R6491:Acad10 UTSW 5 121630157 missense probably damaging 1.00
R6608:Acad10 UTSW 5 121632492 missense probably benign 0.02
R6941:Acad10 UTSW 5 121649357 missense probably damaging 1.00
R7221:Acad10 UTSW 5 121630210 missense probably damaging 1.00
R7283:Acad10 UTSW 5 121649475 missense possibly damaging 0.79
R7355:Acad10 UTSW 5 121630717 nonsense probably null
R7483:Acad10 UTSW 5 121656012 critical splice donor site probably null
R7553:Acad10 UTSW 5 121639255 missense probably damaging 1.00
R7721:Acad10 UTSW 5 121646866 splice site probably null
R8075:Acad10 UTSW 5 121652085 missense probably benign 0.00
X0061:Acad10 UTSW 5 121622813 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCCGCTGGAAAGATGAAAGTTG -3'
(R):5'- AACGTCAAAAGCTCAGGTCCTCTTC -3'

Sequencing Primer
(F):5'- AAAGTTGTTGGTGAGGACTGC -3'
(R):5'- gtatggaggctgaagcagg -3'
Posted On2014-01-05