Mutagenetix > Incidental Mutation

Incidental Mutation 'R1052:Acad10'

94036

Institutional Source

Beutler Lab

Gene Symbol

Acad10

Ensembl Gene

ENSMUSG00000029456

Gene Name

acyl-Coenzyme A dehydrogenase family, member 10

Synonyms

2410021P16Rik

MMRRC Submission

039142-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1052 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121621026-121660514 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 121649541 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 115 (T115I)

Ref Sequence

ENSEMBL: ENSMUSP00000107400 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031412] [ENSMUST00000111770]

AlphaFold

Q8K370

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031412
AA Change: T115I

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000031412
Gene: ENSMUSG00000029456
AA Change: T115I

Domain	Start	End	E-Value	Type
Pfam:HAD_2	45	231	1.6e-14	PFAM
Pfam:Hydrolase	88	225	5e-8	PFAM
Pfam:APH	287	531	1.8e-52	PFAM
Pfam:Acyl-CoA_dh_N	660	787	1.7e-15	PFAM
Pfam:Acyl-CoA_dh_M	791	892	2.7e-20	PFAM
Pfam:Acyl-CoA_dh_1	904	1055	1.1e-35	PFAM
Pfam:Acyl-CoA_dh_2	919	1037	6.4e-13	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111770
AA Change: T115I

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000107400
Gene: ENSMUSG00000029456
AA Change: T115I

Domain	Start	End	E-Value	Type
Pfam:HAD_2	45	231	2.3e-14	PFAM
Pfam:APH	287	523	3.2e-50	PFAM
Pfam:EcKinase	390	504	5.2e-8	PFAM
Pfam:Acyl-CoA_dh_N	660	787	3.4e-14	PFAM
Pfam:Acyl-CoA_dh_M	791	845	2.7e-13	PFAM
Pfam:Acyl-CoA_dh_1	904	1055	9.4e-36	PFAM
Pfam:Acyl-CoA_dh_2	919	1037	1.6e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133775

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137231

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA dehydrogenase family of enzymes (ACADs), which participate in the beta-oxidation of fatty acids in mitochondria. The encoded enzyme contains a hydrolase domain at the N-terminal portion, a serine/threonine protein kinase catlytic domain in the central region, and a conserved ACAD domain at the C-terminus. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Nov 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb2	A	T	2: 103,705,072	Y528F	possibly damaging	Het
Adam19	T	C	11: 46,127,265	F385L	probably damaging	Het
Adgb	T	C	10: 10,442,613	N162D	probably benign	Het
Arhgap20	C	A	9: 51,846,270	P521T	probably damaging	Het
Arsa	A	T	15: 89,475,177	L134Q	probably damaging	Het
Atp5b	A	G	10: 128,090,052	Y508C	probably damaging	Het
AW554918	G	A	18: 25,420,010	M287I	probably benign	Het
Bmp4	T	C	14: 46,383,903	K395E	probably damaging	Het
Cacna2d4	A	G	6: 119,300,333	Y669C	probably damaging	Het
Casq2	T	C	3: 102,144,234		probably null	Het
Cdk5rap1	A	T	2: 154,360,599	I237N	possibly damaging	Het
Cerk	G	C	15: 86,149,364	S286C	possibly damaging	Het
Cir1	A	C	2: 73,287,643	L186R	probably damaging	Het
Csf3r	A	T	4: 126,042,988		probably null	Het
Cyp3a41a	A	T	5: 145,705,811	I246K	possibly damaging	Het
Cyp8b1	A	G	9: 121,915,282	F328S	possibly damaging	Het
Dzank1	A	T	2: 144,513,445	V110D	probably benign	Het
Gm13089	T	C	4: 143,696,907	I437M	possibly damaging	Het
Gm6729	T	A	10: 86,540,935		noncoding transcript	Het
Gnpat	T	C	8: 124,877,507	F246L	probably benign	Het
Gnpat	T	A	8: 124,878,516	L248H	probably damaging	Het
Gstm7	T	C	3: 107,926,950	T163A	probably benign	Het
Hspa5	A	G	2: 34,775,098	T424A	probably damaging	Het
Itgb1	T	G	8: 128,713,305	D158E	probably damaging	Het
Kif21a	A	G	15: 90,935,650	V1637A	probably benign	Het
Kl	G	T	5: 150,982,520	V452F	probably damaging	Het
Krt23	T	C	11: 99,478,219	N416S	probably benign	Het
Lama4	A	T	10: 39,092,245	H1461L	possibly damaging	Het
Lamc3	A	G	2: 31,928,802	T1180A	probably benign	Het
Mboat2	T	C	12: 24,946,528	Y145H	probably damaging	Het
Mlxipl	T	A	5: 135,113,710	I126N	probably damaging	Het
Myo16	T	A	8: 10,570,181	N1577K	possibly damaging	Het
Nlrp4f	A	G	13: 65,185,083	V87A	possibly damaging	Het
Olfr1039	A	G	2: 86,131,571	F31L	probably benign	Het
Olfr414	A	T	1: 174,431,135	K236*	probably null	Het
Pask	A	T	1: 93,330,827	D266E	probably benign	Het
Pcdhb17	A	G	18: 37,486,846	Y563C	probably damaging	Het
Pdlim3	T	A	8: 45,896,800	I49N	probably damaging	Het
Pla2g4c	T	A	7: 13,343,409	V292E	possibly damaging	Het
Prrt4	G	T	6: 29,169,814	Q880K	possibly damaging	Het
Pygb	A	G	2: 150,786,938	D24G	probably benign	Het
R3hcc1l	T	A	19: 42,563,654	D363E	probably damaging	Het
Rif1	A	C	2: 52,111,562	Q1676P	probably benign	Het
Ryr1	C	A	7: 29,096,258	R1069L	probably damaging	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Slc2a13	A	G	15: 91,412,160	V317A	probably damaging	Het
Slc35b4	A	T	6: 34,161,684	F197I	probably damaging	Het
Tchhl1	G	A	3: 93,470,213	V75I	probably benign	Het
Ubr4	T	C	4: 139,455,460	S3521P	possibly damaging	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp335	GTCCTCCTCCTCCTCCTC	GTCCTCCTCCTCCTC	2: 164,907,468		probably benign	Het
Zfp874a	T	G	13: 67,442,420	I382L	possibly damaging	Het

Other mutations in Acad10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02379:Acad10	APN	5	121622043	missense	probably damaging	1.00
IGL02469:Acad10	APN	5	121645459	missense	probably damaging	1.00
IGL02526:Acad10	APN	5	121646860	missense	probably damaging	0.99
IGL02623:Acad10	APN	5	121629930	missense	possibly damaging	0.94
IGL02643:Acad10	APN	5	121631570	missense	probably benign
IGL02685:Acad10	APN	5	121632609	missense	probably benign
IGL03139:Acad10	APN	5	121626082	missense	probably benign
IGL03267:Acad10	APN	5	121637349	missense	probably benign	0.34
P0026:Acad10	UTSW	5	121637352	missense	probably damaging	1.00
R0099:Acad10	UTSW	5	121621290	missense	probably damaging	1.00
R0453:Acad10	UTSW	5	121627382	nonsense	probably null
R1051:Acad10	UTSW	5	121626080	missense	probably damaging	0.97
R1116:Acad10	UTSW	5	121630751	missense	probably damaging	1.00
R1548:Acad10	UTSW	5	121626040	splice site	probably benign
R1548:Acad10	UTSW	5	121626041	splice site	probably benign
R1571:Acad10	UTSW	5	121621348	missense	probably damaging	0.99
R1592:Acad10	UTSW	5	121645381	missense	probably damaging	0.99
R1741:Acad10	UTSW	5	121647836	missense	probably damaging	1.00
R1789:Acad10	UTSW	5	121631393	missense	possibly damaging	0.67
R1974:Acad10	UTSW	5	121626185	missense	possibly damaging	0.95
R2007:Acad10	UTSW	5	121634751	missense	probably damaging	1.00
R2085:Acad10	UTSW	5	121649460	missense	possibly damaging	0.79
R2351:Acad10	UTSW	5	121629927	missense	probably benign	0.23
R2511:Acad10	UTSW	5	121631567	missense	probably benign	0.02
R2570:Acad10	UTSW	5	121630204	missense	probably damaging	1.00
R3824:Acad10	UTSW	5	121622818	missense	probably benign
R3846:Acad10	UTSW	5	121634686	missense	probably benign	0.19
R4106:Acad10	UTSW	5	121631464	missense	probably damaging	0.98
R4107:Acad10	UTSW	5	121631464	missense	probably damaging	0.98
R4108:Acad10	UTSW	5	121631464	missense	probably damaging	0.98
R5569:Acad10	UTSW	5	121626080	missense	probably damaging	0.97
R5704:Acad10	UTSW	5	121631543	missense	probably benign	0.03
R5845:Acad10	UTSW	5	121626083	missense	probably benign
R5990:Acad10	UTSW	5	121645405	missense	probably damaging	1.00
R6019:Acad10	UTSW	5	121634801	missense	possibly damaging	0.88
R6145:Acad10	UTSW	5	121622033	missense	probably damaging	0.97
R6384:Acad10	UTSW	5	121652003	missense	probably benign	0.43
R6491:Acad10	UTSW	5	121630157	missense	probably damaging	1.00
R6608:Acad10	UTSW	5	121632492	missense	probably benign	0.02
R6941:Acad10	UTSW	5	121649357	missense	probably damaging	1.00
R7221:Acad10	UTSW	5	121630210	missense	probably damaging	1.00
R7283:Acad10	UTSW	5	121649475	missense	possibly damaging	0.79
R7355:Acad10	UTSW	5	121630717	nonsense	probably null
R7483:Acad10	UTSW	5	121656012	critical splice donor site	probably null
R7553:Acad10	UTSW	5	121639255	missense	probably damaging	1.00
R7721:Acad10	UTSW	5	121646866	splice site	probably null
R8075:Acad10	UTSW	5	121652085	missense	probably benign	0.00
R8400:Acad10	UTSW	5	121626205	missense	possibly damaging	0.82
R9171:Acad10	UTSW	5	121629918	missense	probably benign	0.14
X0061:Acad10	UTSW	5	121622813	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCCGCTGGAAAGATGAAAGTTG -3'
(R):5'- AACGTCAAAAGCTCAGGTCCTCTTC -3'

Sequencing Primer
(F):5'- AAAGTTGTTGGTGAGGACTGC -3'
(R):5'- gtatggaggctgaagcagg -3'

Posted On

2014-01-05