Incidental Mutation 'R1052:Kl'
ID94040
Institutional Source Beutler Lab
Gene Symbol Kl
Ensembl Gene ENSMUSG00000058488
Gene Nameklotho
Synonymsalpha-kl
MMRRC Submission 039142-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1052 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location150952607-150993817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 150982520 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 452 (V452F)
Ref Sequence ENSEMBL: ENSMUSP00000077899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078856]
Predicted Effect probably damaging
Transcript: ENSMUST00000078856
AA Change: V452F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077899
Gene: ENSMUSG00000058488
AA Change: V452F

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 45 56 N/A INTRINSIC
Pfam:Glyco_hydro_1 59 380 4.3e-99 PFAM
Pfam:Glyco_hydro_1 376 508 7.9e-33 PFAM
Pfam:Glyco_hydro_1 517 955 1e-79 PFAM
transmembrane domain 984 1006 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202096
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I membrane protein that is related to beta-glucosidases. Reduced production of this protein has been observed in patients with chronic renal failure (CRF), and this may be one of the factors underlying the degenerative processes (e.g., arteriosclerosis, osteoporosis, and skin atrophy) seen in CRF. Also, mutations within this protein have been associated with ageing and bone loss. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have a short lifespan and growth retardation with one allele homeostatic imbalances and soft tissue calcification are also seen. With a second allele abnormal cancellous bone and femur morphology are seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,705,072 Y528F possibly damaging Het
Acad10 G A 5: 121,649,541 T115I possibly damaging Het
Adam19 T C 11: 46,127,265 F385L probably damaging Het
Adgb T C 10: 10,442,613 N162D probably benign Het
Arhgap20 C A 9: 51,846,270 P521T probably damaging Het
Arsa A T 15: 89,475,177 L134Q probably damaging Het
Atp5b A G 10: 128,090,052 Y508C probably damaging Het
AW554918 G A 18: 25,420,010 M287I probably benign Het
Bmp4 T C 14: 46,383,903 K395E probably damaging Het
Cacna2d4 A G 6: 119,300,333 Y669C probably damaging Het
Casq2 T C 3: 102,144,234 probably null Het
Cdk5rap1 A T 2: 154,360,599 I237N possibly damaging Het
Cerk G C 15: 86,149,364 S286C possibly damaging Het
Cir1 A C 2: 73,287,643 L186R probably damaging Het
Csf3r A T 4: 126,042,988 probably null Het
Cyp3a41a A T 5: 145,705,811 I246K possibly damaging Het
Cyp8b1 A G 9: 121,915,282 F328S possibly damaging Het
Dzank1 A T 2: 144,513,445 V110D probably benign Het
Gm13089 T C 4: 143,696,907 I437M possibly damaging Het
Gm6729 T A 10: 86,540,935 noncoding transcript Het
Gnpat T C 8: 124,877,507 F246L probably benign Het
Gnpat T A 8: 124,878,516 L248H probably damaging Het
Gstm7 T C 3: 107,926,950 T163A probably benign Het
Hspa5 A G 2: 34,775,098 T424A probably damaging Het
Itgb1 T G 8: 128,713,305 D158E probably damaging Het
Kif21a A G 15: 90,935,650 V1637A probably benign Het
Krt23 T C 11: 99,478,219 N416S probably benign Het
Lama4 A T 10: 39,092,245 H1461L possibly damaging Het
Lamc3 A G 2: 31,928,802 T1180A probably benign Het
Mboat2 T C 12: 24,946,528 Y145H probably damaging Het
Mlxipl T A 5: 135,113,710 I126N probably damaging Het
Myo16 T A 8: 10,570,181 N1577K possibly damaging Het
Nlrp4f A G 13: 65,185,083 V87A possibly damaging Het
Olfr1039 A G 2: 86,131,571 F31L probably benign Het
Olfr414 A T 1: 174,431,135 K236* probably null Het
Pask A T 1: 93,330,827 D266E probably benign Het
Pcdhb17 A G 18: 37,486,846 Y563C probably damaging Het
Pdlim3 T A 8: 45,896,800 I49N probably damaging Het
Pla2g4c T A 7: 13,343,409 V292E possibly damaging Het
Prrt4 G T 6: 29,169,814 Q880K possibly damaging Het
Pygb A G 2: 150,786,938 D24G probably benign Het
R3hcc1l T A 19: 42,563,654 D363E probably damaging Het
Rif1 A C 2: 52,111,562 Q1676P probably benign Het
Ryr1 C A 7: 29,096,258 R1069L probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc2a13 A G 15: 91,412,160 V317A probably damaging Het
Slc35b4 A T 6: 34,161,684 F197I probably damaging Het
Tchhl1 G A 3: 93,470,213 V75I probably benign Het
Ubr4 T C 4: 139,455,460 S3521P possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp335 GTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTC 2: 164,907,468 probably benign Het
Zfp874a T G 13: 67,442,420 I382L possibly damaging Het
Other mutations in Kl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Kl APN 5 150980768 nonsense probably null
IGL00815:Kl APN 5 150980850 missense possibly damaging 0.55
IGL00840:Kl APN 5 150980787 missense possibly damaging 0.90
IGL01347:Kl APN 5 150980665 missense probably damaging 1.00
IGL01642:Kl APN 5 150980869 missense possibly damaging 0.58
IGL01774:Kl APN 5 150988483 missense probably benign 0.00
IGL01937:Kl APN 5 150988937 missense probably damaging 0.99
IGL01945:Kl APN 5 150988937 missense probably damaging 0.99
IGL02510:Kl APN 5 150989001 missense probably damaging 1.00
IGL02696:Kl APN 5 150980985 missense probably benign 0.01
IGL03028:Kl APN 5 150991550 missense probably damaging 1.00
IGL03149:Kl APN 5 150982735 nonsense probably null
anatolia UTSW 5 150988853 missense possibly damaging 0.69
ararat UTSW 5 150988853 missense possibly damaging 0.69
R0480:Kl UTSW 5 150953288 missense probably damaging 1.00
R0565:Kl UTSW 5 150980944 missense possibly damaging 0.76
R0723:Kl UTSW 5 150953101 missense probably damaging 1.00
R1205:Kl UTSW 5 150980688 missense probably damaging 1.00
R1512:Kl UTSW 5 150988597 missense probably benign 0.00
R1529:Kl UTSW 5 150988941 missense probably benign
R1588:Kl UTSW 5 150982632 missense probably benign 0.20
R1714:Kl UTSW 5 150953333 missense probably benign 0.05
R1748:Kl UTSW 5 150980985 missense possibly damaging 0.87
R1885:Kl UTSW 5 150953494 missense possibly damaging 0.67
R1920:Kl UTSW 5 150982667 missense probably benign 0.15
R2156:Kl UTSW 5 150988960 missense probably benign 0.41
R2926:Kl UTSW 5 150953341 missense probably damaging 1.00
R4837:Kl UTSW 5 150980847 missense possibly damaging 0.90
R5221:Kl UTSW 5 150989151 missense probably damaging 1.00
R5687:Kl UTSW 5 150988466 missense possibly damaging 0.84
R5726:Kl UTSW 5 150991538 missense possibly damaging 0.91
R5727:Kl UTSW 5 150991538 missense possibly damaging 0.91
R5735:Kl UTSW 5 150991538 missense possibly damaging 0.91
R5797:Kl UTSW 5 150991538 missense possibly damaging 0.91
R5933:Kl UTSW 5 150989483 missense probably damaging 1.00
R6075:Kl UTSW 5 150953001 missense probably damaging 1.00
R6076:Kl UTSW 5 150953001 missense probably damaging 1.00
R6077:Kl UTSW 5 150953001 missense probably damaging 1.00
R6149:Kl UTSW 5 150988853 missense possibly damaging 0.69
R6150:Kl UTSW 5 150988853 missense possibly damaging 0.69
R6151:Kl UTSW 5 150988853 missense possibly damaging 0.69
R6158:Kl UTSW 5 150988853 missense possibly damaging 0.69
R6236:Kl UTSW 5 150953290 missense probably damaging 1.00
R6609:Kl UTSW 5 150988962 missense probably benign 0.00
R7489:Kl UTSW 5 150952996 missense probably damaging 1.00
RF005:Kl UTSW 5 150953420 missense probably benign 0.07
RF024:Kl UTSW 5 150953420 missense probably benign 0.07
X0066:Kl UTSW 5 150991615 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTCTGGGAATAAGAAACTCCACTGTG -3'
(R):5'- GCTTTTGGTAGAACAAGGCCGAAGAC -3'

Sequencing Primer
(F):5'- atgcccacagaggccag -3'
(R):5'- GAAGACTTTGGCAACAGCTC -3'
Posted On2014-01-05