Incidental Mutation 'R1052:Prrt4'
ID94041
Institutional Source Beutler Lab
Gene Symbol Prrt4
Ensembl Gene ENSMUSG00000079654
Gene Nameproline-rich transmembrane protein 4
Synonyms
MMRRC Submission 039142-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R1052 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location29169232-29179584 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 29169814 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 880 (Q880K)
Ref Sequence ENSEMBL: ENSMUSP00000123751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007993] [ENSMUST00000159200]
Predicted Effect probably benign
Transcript: ENSMUST00000007993
SMART Domains Protein: ENSMUSP00000007993
Gene: ENSMUSG00000029701

DomainStartEndE-ValueType
RRM 5 76 3.51e-19 SMART
low complexity region 99 114 N/A INTRINSIC
RRM 115 187 4.52e-22 SMART
low complexity region 225 248 N/A INTRINSIC
low complexity region 267 291 N/A INTRINSIC
low complexity region 294 306 N/A INTRINSIC
RRM 326 405 1.85e-18 SMART
RRM 478 566 5.46e-7 SMART
low complexity region 707 720 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159200
AA Change: Q880K

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123751
Gene: ENSMUSG00000079654
AA Change: Q880K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 33 41 N/A INTRINSIC
low complexity region 84 90 N/A INTRINSIC
low complexity region 152 171 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
transmembrane domain 367 389 N/A INTRINSIC
transmembrane domain 396 418 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 467 489 N/A INTRINSIC
transmembrane domain 504 521 N/A INTRINSIC
low complexity region 607 625 N/A INTRINSIC
low complexity region 678 702 N/A INTRINSIC
low complexity region 784 824 N/A INTRINSIC
low complexity region 838 854 N/A INTRINSIC
low complexity region 867 882 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,705,072 Y528F possibly damaging Het
Acad10 G A 5: 121,649,541 T115I possibly damaging Het
Adam19 T C 11: 46,127,265 F385L probably damaging Het
Adgb T C 10: 10,442,613 N162D probably benign Het
Arhgap20 C A 9: 51,846,270 P521T probably damaging Het
Arsa A T 15: 89,475,177 L134Q probably damaging Het
Atp5b A G 10: 128,090,052 Y508C probably damaging Het
AW554918 G A 18: 25,420,010 M287I probably benign Het
Bmp4 T C 14: 46,383,903 K395E probably damaging Het
Cacna2d4 A G 6: 119,300,333 Y669C probably damaging Het
Casq2 T C 3: 102,144,234 probably null Het
Cdk5rap1 A T 2: 154,360,599 I237N possibly damaging Het
Cerk G C 15: 86,149,364 S286C possibly damaging Het
Cir1 A C 2: 73,287,643 L186R probably damaging Het
Csf3r A T 4: 126,042,988 probably null Het
Cyp3a41a A T 5: 145,705,811 I246K possibly damaging Het
Cyp8b1 A G 9: 121,915,282 F328S possibly damaging Het
Dzank1 A T 2: 144,513,445 V110D probably benign Het
Gm13089 T C 4: 143,696,907 I437M possibly damaging Het
Gm6729 T A 10: 86,540,935 noncoding transcript Het
Gnpat T C 8: 124,877,507 F246L probably benign Het
Gnpat T A 8: 124,878,516 L248H probably damaging Het
Gstm7 T C 3: 107,926,950 T163A probably benign Het
Hspa5 A G 2: 34,775,098 T424A probably damaging Het
Itgb1 T G 8: 128,713,305 D158E probably damaging Het
Kif21a A G 15: 90,935,650 V1637A probably benign Het
Kl G T 5: 150,982,520 V452F probably damaging Het
Krt23 T C 11: 99,478,219 N416S probably benign Het
Lama4 A T 10: 39,092,245 H1461L possibly damaging Het
Lamc3 A G 2: 31,928,802 T1180A probably benign Het
Mboat2 T C 12: 24,946,528 Y145H probably damaging Het
Mlxipl T A 5: 135,113,710 I126N probably damaging Het
Myo16 T A 8: 10,570,181 N1577K possibly damaging Het
Nlrp4f A G 13: 65,185,083 V87A possibly damaging Het
Olfr1039 A G 2: 86,131,571 F31L probably benign Het
Olfr414 A T 1: 174,431,135 K236* probably null Het
Pask A T 1: 93,330,827 D266E probably benign Het
Pcdhb17 A G 18: 37,486,846 Y563C probably damaging Het
Pdlim3 T A 8: 45,896,800 I49N probably damaging Het
Pla2g4c T A 7: 13,343,409 V292E possibly damaging Het
Pygb A G 2: 150,786,938 D24G probably benign Het
R3hcc1l T A 19: 42,563,654 D363E probably damaging Het
Rif1 A C 2: 52,111,562 Q1676P probably benign Het
Ryr1 C A 7: 29,096,258 R1069L probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc2a13 A G 15: 91,412,160 V317A probably damaging Het
Slc35b4 A T 6: 34,161,684 F197I probably damaging Het
Tchhl1 G A 3: 93,470,213 V75I probably benign Het
Ubr4 T C 4: 139,455,460 S3521P possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp335 GTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTC 2: 164,907,468 probably benign Het
Zfp874a T G 13: 67,442,420 I382L possibly damaging Het
Other mutations in Prrt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Prrt4 APN 6 29176456 missense probably benign 0.33
IGL01585:Prrt4 APN 6 29177690 missense probably benign 0.05
IGL03015:Prrt4 APN 6 29169997 missense probably benign 0.27
R0143:Prrt4 UTSW 6 29170671 missense probably damaging 1.00
R0586:Prrt4 UTSW 6 29171184 missense probably damaging 1.00
R1391:Prrt4 UTSW 6 29169951 missense possibly damaging 0.90
R3907:Prrt4 UTSW 6 29177174 missense probably damaging 1.00
R4239:Prrt4 UTSW 6 29170164 missense probably damaging 0.97
R4829:Prrt4 UTSW 6 29177182 missense probably benign 0.01
R5070:Prrt4 UTSW 6 29177512 missense probably benign
R5825:Prrt4 UTSW 6 29177183 missense probably benign 0.31
R6023:Prrt4 UTSW 6 29176453 missense probably benign
R6776:Prrt4 UTSW 6 29176552 missense possibly damaging 0.95
R6860:Prrt4 UTSW 6 29170738 missense possibly damaging 0.90
R6984:Prrt4 UTSW 6 29171430 missense probably benign 0.18
R7032:Prrt4 UTSW 6 29170539 missense possibly damaging 0.93
R7033:Prrt4 UTSW 6 29171148 missense possibly damaging 0.89
R7444:Prrt4 UTSW 6 29176517 missense probably benign
R7689:Prrt4 UTSW 6 29177141 missense probably damaging 0.97
R7711:Prrt4 UTSW 6 29177456 missense probably benign 0.00
R7735:Prrt4 UTSW 6 29170036 missense possibly damaging 0.90
R7748:Prrt4 UTSW 6 29177191 missense probably damaging 1.00
R7775:Prrt4 UTSW 6 29177719 missense probably damaging 1.00
R7778:Prrt4 UTSW 6 29177719 missense probably damaging 1.00
R7850:Prrt4 UTSW 6 29176901 critical splice donor site probably null
R7880:Prrt4 UTSW 6 29170156 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTCTTGAGCAGATCAGATGCCAG -3'
(R):5'- AGTGAGAAGTCCGAGAATGTCCCTG -3'

Sequencing Primer
(F):5'- GCAGATCAGATGCCAGAAAGTG -3'
(R):5'- TGGACTCTCACGGGACAG -3'
Posted On2014-01-05