Incidental Mutation 'R1052:Slc35b4'
ID94042
Institutional Source Beutler Lab
Gene Symbol Slc35b4
Ensembl Gene ENSMUSG00000018999
Gene Namesolute carrier family 35, member B4
Synonyms4930474D06Rik
MMRRC Submission 039142-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1052 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location34153380-34177111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34161684 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 197 (F197I)
Ref Sequence ENSEMBL: ENSMUSP00000019143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019143] [ENSMUST00000138250]
Predicted Effect probably damaging
Transcript: ENSMUST00000019143
AA Change: F197I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000019143
Gene: ENSMUSG00000018999
AA Change: F197I

DomainStartEndE-ValueType
Pfam:UAA 2 314 1.7e-120 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126498
Predicted Effect probably benign
Transcript: ENSMUST00000138250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146514
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosyltransferases, such as SLC35B4, transport nucleotide sugars from the cytoplasm where they are synthesized, to the Golgi apparatus where they are utilized in the synthesis of glycoproteins, glycolipids, and proteoglycans (Ashikov et al., 2005 [PubMed 15911612]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,705,072 Y528F possibly damaging Het
Acad10 G A 5: 121,649,541 T115I possibly damaging Het
Adam19 T C 11: 46,127,265 F385L probably damaging Het
Adgb T C 10: 10,442,613 N162D probably benign Het
Arhgap20 C A 9: 51,846,270 P521T probably damaging Het
Arsa A T 15: 89,475,177 L134Q probably damaging Het
Atp5b A G 10: 128,090,052 Y508C probably damaging Het
AW554918 G A 18: 25,420,010 M287I probably benign Het
Bmp4 T C 14: 46,383,903 K395E probably damaging Het
Cacna2d4 A G 6: 119,300,333 Y669C probably damaging Het
Casq2 T C 3: 102,144,234 probably null Het
Cdk5rap1 A T 2: 154,360,599 I237N possibly damaging Het
Cerk G C 15: 86,149,364 S286C possibly damaging Het
Cir1 A C 2: 73,287,643 L186R probably damaging Het
Csf3r A T 4: 126,042,988 probably null Het
Cyp3a41a A T 5: 145,705,811 I246K possibly damaging Het
Cyp8b1 A G 9: 121,915,282 F328S possibly damaging Het
Dzank1 A T 2: 144,513,445 V110D probably benign Het
Gm13089 T C 4: 143,696,907 I437M possibly damaging Het
Gm6729 T A 10: 86,540,935 noncoding transcript Het
Gnpat T C 8: 124,877,507 F246L probably benign Het
Gnpat T A 8: 124,878,516 L248H probably damaging Het
Gstm7 T C 3: 107,926,950 T163A probably benign Het
Hspa5 A G 2: 34,775,098 T424A probably damaging Het
Itgb1 T G 8: 128,713,305 D158E probably damaging Het
Kif21a A G 15: 90,935,650 V1637A probably benign Het
Kl G T 5: 150,982,520 V452F probably damaging Het
Krt23 T C 11: 99,478,219 N416S probably benign Het
Lama4 A T 10: 39,092,245 H1461L possibly damaging Het
Lamc3 A G 2: 31,928,802 T1180A probably benign Het
Mboat2 T C 12: 24,946,528 Y145H probably damaging Het
Mlxipl T A 5: 135,113,710 I126N probably damaging Het
Myo16 T A 8: 10,570,181 N1577K possibly damaging Het
Nlrp4f A G 13: 65,185,083 V87A possibly damaging Het
Olfr1039 A G 2: 86,131,571 F31L probably benign Het
Olfr414 A T 1: 174,431,135 K236* probably null Het
Pask A T 1: 93,330,827 D266E probably benign Het
Pcdhb17 A G 18: 37,486,846 Y563C probably damaging Het
Pdlim3 T A 8: 45,896,800 I49N probably damaging Het
Pla2g4c T A 7: 13,343,409 V292E possibly damaging Het
Prrt4 G T 6: 29,169,814 Q880K possibly damaging Het
Pygb A G 2: 150,786,938 D24G probably benign Het
R3hcc1l T A 19: 42,563,654 D363E probably damaging Het
Rif1 A C 2: 52,111,562 Q1676P probably benign Het
Ryr1 C A 7: 29,096,258 R1069L probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc2a13 A G 15: 91,412,160 V317A probably damaging Het
Tchhl1 G A 3: 93,470,213 V75I probably benign Het
Ubr4 T C 4: 139,455,460 S3521P possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp335 GTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTC 2: 164,907,468 probably benign Het
Zfp874a T G 13: 67,442,420 I382L possibly damaging Het
Other mutations in Slc35b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01646:Slc35b4 APN 6 34158429 missense probably benign 0.03
IGL01667:Slc35b4 APN 6 34167675 missense possibly damaging 0.81
IGL01670:Slc35b4 APN 6 34170549 missense probably benign 0.00
IGL02015:Slc35b4 APN 6 34170548 missense probably damaging 1.00
IGL02710:Slc35b4 APN 6 34158541 missense probably benign 0.02
IGL03051:Slc35b4 APN 6 34160471 critical splice donor site probably null
R0008:Slc35b4 UTSW 6 34158517 missense probably damaging 1.00
R0008:Slc35b4 UTSW 6 34158517 missense probably damaging 1.00
R1304:Slc35b4 UTSW 6 34163365 nonsense probably null
R1606:Slc35b4 UTSW 6 34158388 nonsense probably null
R1713:Slc35b4 UTSW 6 34170549 missense probably benign 0.00
R1872:Slc35b4 UTSW 6 34158505 nonsense probably null
R5539:Slc35b4 UTSW 6 34176802 missense probably damaging 0.99
R6954:Slc35b4 UTSW 6 34158621 missense probably benign 0.02
R7339:Slc35b4 UTSW 6 34167656 missense probably damaging 1.00
R7560:Slc35b4 UTSW 6 34163361 missense probably benign 0.01
R8189:Slc35b4 UTSW 6 34167635 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGACTAAAGCCCCTTTGGGAAAC -3'
(R):5'- TGAGTGTGGACAGTCTCATCCTGTG -3'

Sequencing Primer
(F):5'- TGGTTGAACAACTGTACCTACAGG -3'
(R):5'- AAGTGTGGACAGTCTCATCC -3'
Posted On2014-01-05