Incidental Mutation 'R1052:Pla2g4c'
ID94046
Institutional Source Beutler Lab
Gene Symbol Pla2g4c
Ensembl Gene ENSMUSG00000033847
Gene Namephospholipase A2, group IVC (cytosolic, calcium-independent)
SynonymsCPLA2-gamma
MMRRC Submission 039142-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R1052 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location13324655-13360672 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13343409 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 292 (V292E)
Ref Sequence ENSEMBL: ENSMUSP00000127060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043612] [ENSMUST00000108528] [ENSMUST00000167232]
Predicted Effect probably benign
Transcript: ENSMUST00000043612
AA Change: V282E

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000043672
Gene: ENSMUSG00000033847
AA Change: V282E

DomainStartEndE-ValueType
PLAc 1 534 1.97e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108528
AA Change: V292E

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104168
Gene: ENSMUSG00000033847
AA Change: V292E

DomainStartEndE-ValueType
PLAc 1 544 1.23e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157290
Predicted Effect possibly damaging
Transcript: ENSMUST00000167232
AA Change: V292E

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127060
Gene: ENSMUSG00000033847
AA Change: V292E

DomainStartEndE-ValueType
PLAc 1 544 1.23e-8 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a member of the phospholipase A2 enzyme family which hydrolyzes glycerophospholipids to produce free fatty acids and lysophospholipids, both of which serve as precursors in the production of signaling molecules. The encoded protein has been shown to be a calcium-independent and membrane bound enzyme. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,705,072 Y528F possibly damaging Het
Acad10 G A 5: 121,649,541 T115I possibly damaging Het
Adam19 T C 11: 46,127,265 F385L probably damaging Het
Adgb T C 10: 10,442,613 N162D probably benign Het
Arhgap20 C A 9: 51,846,270 P521T probably damaging Het
Arsa A T 15: 89,475,177 L134Q probably damaging Het
Atp5b A G 10: 128,090,052 Y508C probably damaging Het
AW554918 G A 18: 25,420,010 M287I probably benign Het
Bmp4 T C 14: 46,383,903 K395E probably damaging Het
Cacna2d4 A G 6: 119,300,333 Y669C probably damaging Het
Casq2 T C 3: 102,144,234 probably null Het
Cdk5rap1 A T 2: 154,360,599 I237N possibly damaging Het
Cerk G C 15: 86,149,364 S286C possibly damaging Het
Cir1 A C 2: 73,287,643 L186R probably damaging Het
Csf3r A T 4: 126,042,988 probably null Het
Cyp3a41a A T 5: 145,705,811 I246K possibly damaging Het
Cyp8b1 A G 9: 121,915,282 F328S possibly damaging Het
Dzank1 A T 2: 144,513,445 V110D probably benign Het
Gm13089 T C 4: 143,696,907 I437M possibly damaging Het
Gm6729 T A 10: 86,540,935 noncoding transcript Het
Gnpat T C 8: 124,877,507 F246L probably benign Het
Gnpat T A 8: 124,878,516 L248H probably damaging Het
Gstm7 T C 3: 107,926,950 T163A probably benign Het
Hspa5 A G 2: 34,775,098 T424A probably damaging Het
Itgb1 T G 8: 128,713,305 D158E probably damaging Het
Kif21a A G 15: 90,935,650 V1637A probably benign Het
Kl G T 5: 150,982,520 V452F probably damaging Het
Krt23 T C 11: 99,478,219 N416S probably benign Het
Lama4 A T 10: 39,092,245 H1461L possibly damaging Het
Lamc3 A G 2: 31,928,802 T1180A probably benign Het
Mboat2 T C 12: 24,946,528 Y145H probably damaging Het
Mlxipl T A 5: 135,113,710 I126N probably damaging Het
Myo16 T A 8: 10,570,181 N1577K possibly damaging Het
Nlrp4f A G 13: 65,185,083 V87A possibly damaging Het
Olfr1039 A G 2: 86,131,571 F31L probably benign Het
Olfr414 A T 1: 174,431,135 K236* probably null Het
Pask A T 1: 93,330,827 D266E probably benign Het
Pcdhb17 A G 18: 37,486,846 Y563C probably damaging Het
Pdlim3 T A 8: 45,896,800 I49N probably damaging Het
Prrt4 G T 6: 29,169,814 Q880K possibly damaging Het
Pygb A G 2: 150,786,938 D24G probably benign Het
R3hcc1l T A 19: 42,563,654 D363E probably damaging Het
Rif1 A C 2: 52,111,562 Q1676P probably benign Het
Ryr1 C A 7: 29,096,258 R1069L probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc2a13 A G 15: 91,412,160 V317A probably damaging Het
Slc35b4 A T 6: 34,161,684 F197I probably damaging Het
Tchhl1 G A 3: 93,470,213 V75I probably benign Het
Ubr4 T C 4: 139,455,460 S3521P possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp335 GTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTC 2: 164,907,468 probably benign Het
Zfp874a T G 13: 67,442,420 I382L possibly damaging Het
Other mutations in Pla2g4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Pla2g4c APN 7 13344026 missense probably benign 0.01
IGL00972:Pla2g4c APN 7 13340658 missense probably benign 0.13
IGL01759:Pla2g4c APN 7 13348316 missense probably damaging 1.00
IGL02567:Pla2g4c APN 7 13346040 missense probably damaging 1.00
IGL02629:Pla2g4c APN 7 13335377 nonsense probably null
IGL02719:Pla2g4c APN 7 13330094 missense probably damaging 1.00
IGL02812:Pla2g4c APN 7 13348365 missense probably damaging 1.00
PIT4142001:Pla2g4c UTSW 7 13343391 missense probably benign
R0184:Pla2g4c UTSW 7 13356220 missense probably benign 0.16
R1747:Pla2g4c UTSW 7 13337730 splice site probably benign
R4381:Pla2g4c UTSW 7 13346065 missense probably damaging 1.00
R4486:Pla2g4c UTSW 7 13337751 missense probably benign 0.09
R4674:Pla2g4c UTSW 7 13343514 missense probably null 0.24
R4811:Pla2g4c UTSW 7 13337813 missense probably damaging 1.00
R5655:Pla2g4c UTSW 7 13329964 splice site probably null
R5791:Pla2g4c UTSW 7 13339692 missense probably benign 0.32
R5814:Pla2g4c UTSW 7 13340618 missense probably damaging 1.00
R6381:Pla2g4c UTSW 7 13344008 missense probably benign 0.05
R6395:Pla2g4c UTSW 7 13344008 missense probably benign 0.05
R6974:Pla2g4c UTSW 7 13344534 critical splice donor site probably null
R7257:Pla2g4c UTSW 7 13325744 missense possibly damaging 0.46
R7823:Pla2g4c UTSW 7 13330019 missense probably damaging 1.00
Z1088:Pla2g4c UTSW 7 13329753 missense probably benign 0.13
Z1177:Pla2g4c UTSW 7 13348327 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGGGAGGACCATTCAGGTTGTAAGG -3'
(R):5'- ACGTATCAGGGCATCAGGGATCAC -3'

Sequencing Primer
(F):5'- GACCATTCAGGTTGTAAGGAATTGC -3'
(R):5'- GCATCAGGGATCACTGGTATACAC -3'
Posted On2014-01-05