Incidental Mutation 'R1052:Gnpat'
ID94054
Institutional Source Beutler Lab
Gene Symbol Gnpat
Ensembl Gene ENSMUSG00000031985
Gene Nameglyceronephosphate O-acyltransferase
SynonymsD1Ertd819e
MMRRC Submission 039142-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R1052 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location124863033-124890057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124877507 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 246 (F246L)
Ref Sequence ENSEMBL: ENSMUSP00000125323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034466] [ENSMUST00000161986]
Predicted Effect probably benign
Transcript: ENSMUST00000034466
AA Change: F256L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000034466
Gene: ENSMUSG00000031985
AA Change: F256L

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
SCOP:d1dbha1 27 146 6e-3 SMART
PlsC 155 284 8.3e-21 SMART
Blast:PlsC 308 336 1e-6 BLAST
low complexity region 638 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161986
AA Change: F246L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125323
Gene: ENSMUSG00000031985
AA Change: F246L

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
PlsC 145 274 8.3e-21 SMART
Blast:PlsC 298 326 2e-6 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme located in the peroxisomal membrane which is essential to the synthesis of ether phospholipids. Mutations in this gene are associated with rhizomelic chondrodysplasia punctata. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice lack plasmalogens due to inactivation of ether lipid synthesis. Mutant mice exhibit dwarfism, male infertility, defects in eye development, and optic nerve hypoplasia. While some mice die prematurely, others, particularly females, are long-lived. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,705,072 Y528F possibly damaging Het
Acad10 G A 5: 121,649,541 T115I possibly damaging Het
Adam19 T C 11: 46,127,265 F385L probably damaging Het
Adgb T C 10: 10,442,613 N162D probably benign Het
Arhgap20 C A 9: 51,846,270 P521T probably damaging Het
Arsa A T 15: 89,475,177 L134Q probably damaging Het
Atp5b A G 10: 128,090,052 Y508C probably damaging Het
AW554918 G A 18: 25,420,010 M287I probably benign Het
Bmp4 T C 14: 46,383,903 K395E probably damaging Het
Cacna2d4 A G 6: 119,300,333 Y669C probably damaging Het
Casq2 T C 3: 102,144,234 probably null Het
Cdk5rap1 A T 2: 154,360,599 I237N possibly damaging Het
Cerk G C 15: 86,149,364 S286C possibly damaging Het
Cir1 A C 2: 73,287,643 L186R probably damaging Het
Csf3r A T 4: 126,042,988 probably null Het
Cyp3a41a A T 5: 145,705,811 I246K possibly damaging Het
Cyp8b1 A G 9: 121,915,282 F328S possibly damaging Het
Dzank1 A T 2: 144,513,445 V110D probably benign Het
Gm13089 T C 4: 143,696,907 I437M possibly damaging Het
Gm6729 T A 10: 86,540,935 noncoding transcript Het
Gstm7 T C 3: 107,926,950 T163A probably benign Het
Hspa5 A G 2: 34,775,098 T424A probably damaging Het
Itgb1 T G 8: 128,713,305 D158E probably damaging Het
Kif21a A G 15: 90,935,650 V1637A probably benign Het
Kl G T 5: 150,982,520 V452F probably damaging Het
Krt23 T C 11: 99,478,219 N416S probably benign Het
Lama4 A T 10: 39,092,245 H1461L possibly damaging Het
Lamc3 A G 2: 31,928,802 T1180A probably benign Het
Mboat2 T C 12: 24,946,528 Y145H probably damaging Het
Mlxipl T A 5: 135,113,710 I126N probably damaging Het
Myo16 T A 8: 10,570,181 N1577K possibly damaging Het
Nlrp4f A G 13: 65,185,083 V87A possibly damaging Het
Olfr1039 A G 2: 86,131,571 F31L probably benign Het
Olfr414 A T 1: 174,431,135 K236* probably null Het
Pask A T 1: 93,330,827 D266E probably benign Het
Pcdhb17 A G 18: 37,486,846 Y563C probably damaging Het
Pdlim3 T A 8: 45,896,800 I49N probably damaging Het
Pla2g4c T A 7: 13,343,409 V292E possibly damaging Het
Prrt4 G T 6: 29,169,814 Q880K possibly damaging Het
Pygb A G 2: 150,786,938 D24G probably benign Het
R3hcc1l T A 19: 42,563,654 D363E probably damaging Het
Rif1 A C 2: 52,111,562 Q1676P probably benign Het
Ryr1 C A 7: 29,096,258 R1069L probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc2a13 A G 15: 91,412,160 V317A probably damaging Het
Slc35b4 A T 6: 34,161,684 F197I probably damaging Het
Tchhl1 G A 3: 93,470,213 V75I probably benign Het
Ubr4 T C 4: 139,455,460 S3521P possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp335 GTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTC 2: 164,907,468 probably benign Het
Zfp874a T G 13: 67,442,420 I382L possibly damaging Het
Other mutations in Gnpat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Gnpat APN 8 124876914 splice site probably benign
IGL00422:Gnpat APN 8 124885013 missense probably damaging 1.00
IGL01327:Gnpat APN 8 124878633 missense probably damaging 1.00
IGL02257:Gnpat APN 8 124886848 unclassified probably benign
IGL02951:Gnpat APN 8 124870905 missense probably benign 0.01
IGL03084:Gnpat APN 8 124878899 missense probably damaging 0.99
R0114:Gnpat UTSW 8 124883357 missense probably benign 0.06
R0394:Gnpat UTSW 8 124880225 missense possibly damaging 0.82
R1023:Gnpat UTSW 8 124870780 missense probably benign 0.28
R1052:Gnpat UTSW 8 124878516 missense probably damaging 1.00
R1537:Gnpat UTSW 8 124870816 missense probably damaging 0.97
R1604:Gnpat UTSW 8 124876961 missense probably damaging 1.00
R1711:Gnpat UTSW 8 124886952 splice site probably null
R1754:Gnpat UTSW 8 124877006 missense probably damaging 1.00
R2118:Gnpat UTSW 8 124876941 missense probably damaging 0.99
R2278:Gnpat UTSW 8 124876920 missense probably benign 0.35
R2429:Gnpat UTSW 8 124877019 missense probably damaging 1.00
R4579:Gnpat UTSW 8 124878502 splice site probably null
R6176:Gnpat UTSW 8 124878854 missense probably damaging 1.00
R7017:Gnpat UTSW 8 124863275 missense probably benign 0.33
R7081:Gnpat UTSW 8 124863269 missense possibly damaging 0.53
R7388:Gnpat UTSW 8 124887814 missense probably benign 0.32
R7716:Gnpat UTSW 8 124876934 missense probably benign 0.32
R7848:Gnpat UTSW 8 124886891 missense possibly damaging 0.89
R8169:Gnpat UTSW 8 124880130 missense probably benign 0.02
X0025:Gnpat UTSW 8 124873399 missense probably null 0.99
Z1177:Gnpat UTSW 8 124863296 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGCACTTGGATTAAGGGTCAGAAGC -3'
(R):5'- ACAGCAGTCCATGTTCCATGTTCC -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- ttcccagggagcccaag -3'
Posted On2014-01-05