Incidental Mutation 'R1052:Cyp8b1'
ID94060
Institutional Source Beutler Lab
Gene Symbol Cyp8b1
Ensembl Gene ENSMUSG00000050445
Gene Namecytochrome P450, family 8, subfamily b, polypeptide 1
Synonymssterol 12-alpha-hydrolase
MMRRC Submission 039142-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R1052 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location121914356-121916305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121915282 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 328 (F328S)
Ref Sequence ENSEMBL: ENSMUSP00000052989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050327] [ENSMUST00000062474] [ENSMUST00000214340]
Predicted Effect probably benign
Transcript: ENSMUST00000050327
SMART Domains Protein: ENSMUSP00000050119
Gene: ENSMUSG00000044534

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
Pfam:7tm_1 62 311 1e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000062474
AA Change: F328S

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000052989
Gene: ENSMUSG00000050445
AA Change: F328S

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Pfam:p450 32 492 5.7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214340
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum membrane protein catalyzes the conversion of 7 alpha-hydroxy-4-cholesten-3-one into 7-alpha,12-alpha-dihydroxy-4-cholesten-3-one. The balance between these two steroids determines the relative amounts of cholic acid and chenodeoxycholic acid both of which are secreted in the bile and affect the solubility of cholesterol. This gene is unique among the cytochrome P450 genes in that it is intronless. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele lack synthsesis of cholate (a primary bile acid) and its metabolites and display an increased bile acid pool and alterations in cholesterol metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,705,072 Y528F possibly damaging Het
Acad10 G A 5: 121,649,541 T115I possibly damaging Het
Adam19 T C 11: 46,127,265 F385L probably damaging Het
Adgb T C 10: 10,442,613 N162D probably benign Het
Arhgap20 C A 9: 51,846,270 P521T probably damaging Het
Arsa A T 15: 89,475,177 L134Q probably damaging Het
Atp5b A G 10: 128,090,052 Y508C probably damaging Het
AW554918 G A 18: 25,420,010 M287I probably benign Het
Bmp4 T C 14: 46,383,903 K395E probably damaging Het
Cacna2d4 A G 6: 119,300,333 Y669C probably damaging Het
Casq2 T C 3: 102,144,234 probably null Het
Cdk5rap1 A T 2: 154,360,599 I237N possibly damaging Het
Cerk G C 15: 86,149,364 S286C possibly damaging Het
Cir1 A C 2: 73,287,643 L186R probably damaging Het
Csf3r A T 4: 126,042,988 probably null Het
Cyp3a41a A T 5: 145,705,811 I246K possibly damaging Het
Dzank1 A T 2: 144,513,445 V110D probably benign Het
Gm13089 T C 4: 143,696,907 I437M possibly damaging Het
Gm6729 T A 10: 86,540,935 noncoding transcript Het
Gnpat T C 8: 124,877,507 F246L probably benign Het
Gnpat T A 8: 124,878,516 L248H probably damaging Het
Gstm7 T C 3: 107,926,950 T163A probably benign Het
Hspa5 A G 2: 34,775,098 T424A probably damaging Het
Itgb1 T G 8: 128,713,305 D158E probably damaging Het
Kif21a A G 15: 90,935,650 V1637A probably benign Het
Kl G T 5: 150,982,520 V452F probably damaging Het
Krt23 T C 11: 99,478,219 N416S probably benign Het
Lama4 A T 10: 39,092,245 H1461L possibly damaging Het
Lamc3 A G 2: 31,928,802 T1180A probably benign Het
Mboat2 T C 12: 24,946,528 Y145H probably damaging Het
Mlxipl T A 5: 135,113,710 I126N probably damaging Het
Myo16 T A 8: 10,570,181 N1577K possibly damaging Het
Nlrp4f A G 13: 65,185,083 V87A possibly damaging Het
Olfr1039 A G 2: 86,131,571 F31L probably benign Het
Olfr414 A T 1: 174,431,135 K236* probably null Het
Pask A T 1: 93,330,827 D266E probably benign Het
Pcdhb17 A G 18: 37,486,846 Y563C probably damaging Het
Pdlim3 T A 8: 45,896,800 I49N probably damaging Het
Pla2g4c T A 7: 13,343,409 V292E possibly damaging Het
Prrt4 G T 6: 29,169,814 Q880K possibly damaging Het
Pygb A G 2: 150,786,938 D24G probably benign Het
R3hcc1l T A 19: 42,563,654 D363E probably damaging Het
Rif1 A C 2: 52,111,562 Q1676P probably benign Het
Ryr1 C A 7: 29,096,258 R1069L probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc2a13 A G 15: 91,412,160 V317A probably damaging Het
Slc35b4 A T 6: 34,161,684 F197I probably damaging Het
Tchhl1 G A 3: 93,470,213 V75I probably benign Het
Ubr4 T C 4: 139,455,460 S3521P possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp335 GTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTC 2: 164,907,468 probably benign Het
Zfp874a T G 13: 67,442,420 I382L possibly damaging Het
Other mutations in Cyp8b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Cyp8b1 APN 9 121914995 missense probably damaging 0.98
IGL01874:Cyp8b1 APN 9 121915903 missense possibly damaging 0.71
IGL02004:Cyp8b1 APN 9 121914992 missense probably benign 0.01
IGL02218:Cyp8b1 APN 9 121915117 missense probably damaging 1.00
IGL02606:Cyp8b1 APN 9 121915735 missense probably damaging 1.00
IGL02724:Cyp8b1 APN 9 121915387 missense probably benign 0.12
IGL02796:Cyp8b1 UTSW 9 121915498 missense probably benign
R1223:Cyp8b1 UTSW 9 121915004 missense possibly damaging 0.71
R1572:Cyp8b1 UTSW 9 121914958 missense possibly damaging 0.94
R1639:Cyp8b1 UTSW 9 121914890 missense probably benign 0.01
R3833:Cyp8b1 UTSW 9 121916043 missense probably benign 0.00
R3938:Cyp8b1 UTSW 9 121915618 missense probably benign 0.05
R4151:Cyp8b1 UTSW 9 121916068 missense probably damaging 1.00
R4615:Cyp8b1 UTSW 9 121916098 nonsense probably null
R4625:Cyp8b1 UTSW 9 121915585 missense probably damaging 0.99
R5327:Cyp8b1 UTSW 9 121914884 missense probably damaging 0.99
R6391:Cyp8b1 UTSW 9 121915798 nonsense probably null
R6998:Cyp8b1 UTSW 9 121915993 missense probably benign
R7086:Cyp8b1 UTSW 9 121915289 missense probably benign 0.02
R7162:Cyp8b1 UTSW 9 121915711 missense probably damaging 0.99
R7210:Cyp8b1 UTSW 9 121915180 missense probably damaging 1.00
R7223:Cyp8b1 UTSW 9 121915097 missense probably damaging 1.00
RF013:Cyp8b1 UTSW 9 121915495 missense possibly damaging 0.59
Z1177:Cyp8b1 UTSW 9 121915531 missense probably benign 0.06
Z1177:Cyp8b1 UTSW 9 121916146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCGACTTGTAGAAGTCCACTTTCC -3'
(R):5'- AGACGGCATAAGCTGTTGGTTAGG -3'

Sequencing Primer
(F):5'- ACCGATCATACTTGAAGGCTGTG -3'
(R):5'- GGAATAGCTTCATCCATGCAG -3'
Posted On2014-01-05