Incidental Mutation 'R1052:Atp5b'
ID94070
Institutional Source Beutler Lab
Gene Symbol Atp5b
Ensembl Gene ENSMUSG00000025393
Gene NameATP synthase, H+ transporting mitochondrial F1 complex, beta subunit
Synonyms
MMRRC Submission 039142-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1052 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128083273-128090391 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128090052 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 508 (Y508C)
Ref Sequence ENSEMBL: ENSMUSP00000026459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026459] [ENSMUST00000045621] [ENSMUST00000170054] [ENSMUST00000217851] [ENSMUST00000219072] [ENSMUST00000220049]
Predicted Effect probably damaging
Transcript: ENSMUST00000026459
AA Change: Y508C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026459
Gene: ENSMUSG00000025393
AA Change: Y508C

DomainStartEndE-ValueType
low complexity region 2 38 N/A INTRINSIC
Pfam:ATP-synt_ab_N 63 129 2.9e-23 PFAM
AAA 198 382 1.5e-6 SMART
Pfam:ATP-synt_ab_C 418 527 2.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045621
SMART Domains Protein: ENSMUSP00000044359
Gene: ENSMUSG00000040054

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
low complexity region 342 353 N/A INTRINSIC
low complexity region 421 475 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
MBD 539 614 3.87e-35 SMART
AT_hook 639 651 2.38e0 SMART
AT_hook 660 672 1.65e0 SMART
low complexity region 697 710 N/A INTRINSIC
coiled coil region 736 776 N/A INTRINSIC
DDT 837 902 3.75e-18 SMART
Pfam:WHIM1 939 988 4.8e-8 PFAM
low complexity region 1001 1013 N/A INTRINSIC
AT_hook 1174 1186 6.23e1 SMART
AT_hook 1388 1400 4.21e0 SMART
Pfam:WHIM3 1423 1464 1e-9 PFAM
PHD 1662 1708 1.47e-11 SMART
low complexity region 1741 1753 N/A INTRINSIC
BROMO 1773 1881 7.71e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126040
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144918
Predicted Effect probably benign
Transcript: ENSMUST00000170054
SMART Domains Protein: ENSMUSP00000129803
Gene: ENSMUSG00000040054

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
low complexity region 343 354 N/A INTRINSIC
low complexity region 422 476 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
MBD 540 615 3.87e-35 SMART
AT_hook 640 652 2.38e0 SMART
AT_hook 661 673 1.65e0 SMART
low complexity region 698 711 N/A INTRINSIC
coiled coil region 737 777 N/A INTRINSIC
DDT 838 903 3.75e-18 SMART
Pfam:WHIM1 940 989 4.8e-8 PFAM
low complexity region 1002 1014 N/A INTRINSIC
AT_hook 1175 1187 6.23e1 SMART
AT_hook 1389 1401 4.21e0 SMART
Pfam:WHIM3 1424 1462 5.5e-19 PFAM
PHD 1663 1709 1.47e-11 SMART
low complexity region 1742 1754 N/A INTRINSIC
BROMO 1774 1882 7.71e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197076
Predicted Effect probably benign
Transcript: ENSMUST00000217851
Predicted Effect probably benign
Transcript: ENSMUST00000219072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219082
Predicted Effect probably benign
Transcript: ENSMUST00000220049
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the beta subunit of the catalytic core. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,705,072 Y528F possibly damaging Het
Acad10 G A 5: 121,649,541 T115I possibly damaging Het
Adam19 T C 11: 46,127,265 F385L probably damaging Het
Adgb T C 10: 10,442,613 N162D probably benign Het
Arhgap20 C A 9: 51,846,270 P521T probably damaging Het
Arsa A T 15: 89,475,177 L134Q probably damaging Het
AW554918 G A 18: 25,420,010 M287I probably benign Het
Bmp4 T C 14: 46,383,903 K395E probably damaging Het
Cacna2d4 A G 6: 119,300,333 Y669C probably damaging Het
Casq2 T C 3: 102,144,234 probably null Het
Cdk5rap1 A T 2: 154,360,599 I237N possibly damaging Het
Cerk G C 15: 86,149,364 S286C possibly damaging Het
Cir1 A C 2: 73,287,643 L186R probably damaging Het
Csf3r A T 4: 126,042,988 probably null Het
Cyp3a41a A T 5: 145,705,811 I246K possibly damaging Het
Cyp8b1 A G 9: 121,915,282 F328S possibly damaging Het
Dzank1 A T 2: 144,513,445 V110D probably benign Het
Gm13089 T C 4: 143,696,907 I437M possibly damaging Het
Gm6729 T A 10: 86,540,935 noncoding transcript Het
Gnpat T C 8: 124,877,507 F246L probably benign Het
Gnpat T A 8: 124,878,516 L248H probably damaging Het
Gstm7 T C 3: 107,926,950 T163A probably benign Het
Hspa5 A G 2: 34,775,098 T424A probably damaging Het
Itgb1 T G 8: 128,713,305 D158E probably damaging Het
Kif21a A G 15: 90,935,650 V1637A probably benign Het
Kl G T 5: 150,982,520 V452F probably damaging Het
Krt23 T C 11: 99,478,219 N416S probably benign Het
Lama4 A T 10: 39,092,245 H1461L possibly damaging Het
Lamc3 A G 2: 31,928,802 T1180A probably benign Het
Mboat2 T C 12: 24,946,528 Y145H probably damaging Het
Mlxipl T A 5: 135,113,710 I126N probably damaging Het
Myo16 T A 8: 10,570,181 N1577K possibly damaging Het
Nlrp4f A G 13: 65,185,083 V87A possibly damaging Het
Olfr1039 A G 2: 86,131,571 F31L probably benign Het
Olfr414 A T 1: 174,431,135 K236* probably null Het
Pask A T 1: 93,330,827 D266E probably benign Het
Pcdhb17 A G 18: 37,486,846 Y563C probably damaging Het
Pdlim3 T A 8: 45,896,800 I49N probably damaging Het
Pla2g4c T A 7: 13,343,409 V292E possibly damaging Het
Prrt4 G T 6: 29,169,814 Q880K possibly damaging Het
Pygb A G 2: 150,786,938 D24G probably benign Het
R3hcc1l T A 19: 42,563,654 D363E probably damaging Het
Rif1 A C 2: 52,111,562 Q1676P probably benign Het
Ryr1 C A 7: 29,096,258 R1069L probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc2a13 A G 15: 91,412,160 V317A probably damaging Het
Slc35b4 A T 6: 34,161,684 F197I probably damaging Het
Tchhl1 G A 3: 93,470,213 V75I probably benign Het
Ubr4 T C 4: 139,455,460 S3521P possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp335 GTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTC 2: 164,907,468 probably benign Het
Zfp874a T G 13: 67,442,420 I382L possibly damaging Het
Other mutations in Atp5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02316:Atp5b APN 10 128084309 missense probably benign 0.42
IGL02819:Atp5b APN 10 128083952 missense probably damaging 0.99
R0308:Atp5b UTSW 10 128086039 missense probably benign 0.11
R0496:Atp5b UTSW 10 128086174 missense possibly damaging 0.60
R1418:Atp5b UTSW 10 128083298 start gained probably benign
R1764:Atp5b UTSW 10 128084080 splice site probably benign
R4968:Atp5b UTSW 10 128083987 missense probably damaging 1.00
R5092:Atp5b UTSW 10 128083985 missense probably benign 0.09
R5807:Atp5b UTSW 10 128088562 unclassified probably benign
R7296:Atp5b UTSW 10 128085522 missense probably benign 0.18
R8008:Atp5b UTSW 10 128083408 missense unknown
R8238:Atp5b UTSW 10 128085150 missense possibly damaging 0.75
R8711:Atp5b UTSW 10 128085500 missense probably damaging 1.00
X0057:Atp5b UTSW 10 128090114 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCCCAGAACAGTCAGTGGAGGTTAG -3'
(R):5'- TGTGGCCTGCATGGAAGGAAAC -3'

Sequencing Primer
(F):5'- GCAGTAGTCAGTGTTAAACCAC -3'
(R):5'- CTGCATGGAAGGAAACCTGAG -3'
Posted On2014-01-05