Incidental Mutation 'R1052:Mboat2'
ID94074
Institutional Source Beutler Lab
Gene Symbol Mboat2
Ensembl Gene ENSMUSG00000020646
Gene Namemembrane bound O-acyltransferase domain containing 2
SynonymsOact2, 2810049G06Rik
MMRRC Submission 039142-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1052 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location24830879-24964397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24946528 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 145 (Y145H)
Ref Sequence ENSEMBL: ENSMUSP00000152348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078902] [ENSMUST00000110942] [ENSMUST00000221952] [ENSMUST00000222994]
Predicted Effect probably damaging
Transcript: ENSMUST00000078902
AA Change: Y44H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077937
Gene: ENSMUSG00000020646
AA Change: Y44H

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
Pfam:MBOAT 97 405 8.9e-35 PFAM
transmembrane domain 410 432 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110942
AA Change: Y177H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106567
Gene: ENSMUSG00000020646
AA Change: Y177H

DomainStartEndE-ValueType
Pfam:MBOAT 21 430 2.8e-32 PFAM
transmembrane domain 442 464 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000221952
AA Change: Y145H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222994
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,705,072 Y528F possibly damaging Het
Acad10 G A 5: 121,649,541 T115I possibly damaging Het
Adam19 T C 11: 46,127,265 F385L probably damaging Het
Adgb T C 10: 10,442,613 N162D probably benign Het
Arhgap20 C A 9: 51,846,270 P521T probably damaging Het
Arsa A T 15: 89,475,177 L134Q probably damaging Het
Atp5b A G 10: 128,090,052 Y508C probably damaging Het
AW554918 G A 18: 25,420,010 M287I probably benign Het
Bmp4 T C 14: 46,383,903 K395E probably damaging Het
Cacna2d4 A G 6: 119,300,333 Y669C probably damaging Het
Casq2 T C 3: 102,144,234 probably null Het
Cdk5rap1 A T 2: 154,360,599 I237N possibly damaging Het
Cerk G C 15: 86,149,364 S286C possibly damaging Het
Cir1 A C 2: 73,287,643 L186R probably damaging Het
Csf3r A T 4: 126,042,988 probably null Het
Cyp3a41a A T 5: 145,705,811 I246K possibly damaging Het
Cyp8b1 A G 9: 121,915,282 F328S possibly damaging Het
Dzank1 A T 2: 144,513,445 V110D probably benign Het
Gm13089 T C 4: 143,696,907 I437M possibly damaging Het
Gm6729 T A 10: 86,540,935 noncoding transcript Het
Gnpat T C 8: 124,877,507 F246L probably benign Het
Gnpat T A 8: 124,878,516 L248H probably damaging Het
Gstm7 T C 3: 107,926,950 T163A probably benign Het
Hspa5 A G 2: 34,775,098 T424A probably damaging Het
Itgb1 T G 8: 128,713,305 D158E probably damaging Het
Kif21a A G 15: 90,935,650 V1637A probably benign Het
Kl G T 5: 150,982,520 V452F probably damaging Het
Krt23 T C 11: 99,478,219 N416S probably benign Het
Lama4 A T 10: 39,092,245 H1461L possibly damaging Het
Lamc3 A G 2: 31,928,802 T1180A probably benign Het
Mlxipl T A 5: 135,113,710 I126N probably damaging Het
Myo16 T A 8: 10,570,181 N1577K possibly damaging Het
Nlrp4f A G 13: 65,185,083 V87A possibly damaging Het
Olfr1039 A G 2: 86,131,571 F31L probably benign Het
Olfr414 A T 1: 174,431,135 K236* probably null Het
Pask A T 1: 93,330,827 D266E probably benign Het
Pcdhb17 A G 18: 37,486,846 Y563C probably damaging Het
Pdlim3 T A 8: 45,896,800 I49N probably damaging Het
Pla2g4c T A 7: 13,343,409 V292E possibly damaging Het
Prrt4 G T 6: 29,169,814 Q880K possibly damaging Het
Pygb A G 2: 150,786,938 D24G probably benign Het
R3hcc1l T A 19: 42,563,654 D363E probably damaging Het
Rif1 A C 2: 52,111,562 Q1676P probably benign Het
Ryr1 C A 7: 29,096,258 R1069L probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc2a13 A G 15: 91,412,160 V317A probably damaging Het
Slc35b4 A T 6: 34,161,684 F197I probably damaging Het
Tchhl1 G A 3: 93,470,213 V75I probably benign Het
Ubr4 T C 4: 139,455,460 S3521P possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp335 GTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTC 2: 164,907,468 probably benign Het
Zfp874a T G 13: 67,442,420 I382L possibly damaging Het
Other mutations in Mboat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Mboat2 APN 12 24939354 splice site probably benign
IGL00755:Mboat2 APN 12 24957646 missense probably benign 0.20
IGL01691:Mboat2 APN 12 24954222 missense probably damaging 1.00
IGL02824:Mboat2 APN 12 24946586 missense probably benign 0.03
R1531:Mboat2 UTSW 12 24959030 missense probably benign
R1998:Mboat2 UTSW 12 24946673 missense possibly damaging 0.58
R1999:Mboat2 UTSW 12 24946673 missense possibly damaging 0.58
R2069:Mboat2 UTSW 12 24951443 missense probably benign
R2921:Mboat2 UTSW 12 24954240 missense probably damaging 1.00
R2923:Mboat2 UTSW 12 24954240 missense probably damaging 1.00
R3113:Mboat2 UTSW 12 24882719 missense probably damaging 1.00
R4300:Mboat2 UTSW 12 24959083 missense probably benign 0.33
R5133:Mboat2 UTSW 12 24959066 missense probably benign 0.00
R5356:Mboat2 UTSW 12 24957573 missense probably benign 0.24
R6084:Mboat2 UTSW 12 24878285 missense probably damaging 1.00
R6184:Mboat2 UTSW 12 24951431 missense possibly damaging 0.54
R6194:Mboat2 UTSW 12 24946638 missense probably benign 0.07
R6281:Mboat2 UTSW 12 24957679 missense probably benign 0.18
R7026:Mboat2 UTSW 12 24948382 critical splice donor site probably null
R7269:Mboat2 UTSW 12 24831709 missense probably benign 0.02
R7638:Mboat2 UTSW 12 24939326 missense probably damaging 1.00
Z1176:Mboat2 UTSW 12 24948344 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TCTGCCCCAGCCTCCCGAA -3'
(R):5'- TCAGAAAACTGGACAGACAGATGCTAGG -3'

Sequencing Primer
(F):5'- GCCTCCCGAAATCTTACATGG -3'
(R):5'- CTTCGGATGAGGCGCAAG -3'
Posted On2014-01-05