Incidental Mutation 'R1052:Nlrp4f'
Institutional Source Beutler Lab
Gene Symbol Nlrp4f
Ensembl Gene ENSMUSG00000032999
Gene NameNLR family, pyrin domain containing 4F
SynonymsNalp-kappa, Nalp4f, C330026N02Rik
MMRRC Submission 039142-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R1052 (G1)
Quality Score225
Status Not validated
Chromosomal Location65177111-65205977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65185083 bp
Amino Acid Change Valine to Alanine at position 87 (V87A)
Ref Sequence ENSEMBL: ENSMUSP00000152542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037372] [ENSMUST00000220448] [ENSMUST00000221280] [ENSMUST00000221659] [ENSMUST00000222514]
Predicted Effect probably benign
Transcript: ENSMUST00000037372
AA Change: V795A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000041908
Gene: ENSMUSG00000032999
AA Change: V795A

PYRIN 6 88 1.44e-26 SMART
Pfam:NACHT 147 316 3.4e-39 PFAM
LRR 632 659 1.18e1 SMART
LRR 686 713 4.22e1 SMART
LRR 715 742 5.66e1 SMART
LRR 743 769 4.03e0 SMART
LRR 771 798 1.17e0 SMART
LRR 799 826 1.43e-1 SMART
LRR 828 855 1.03e-2 SMART
LRR 856 883 5.59e-4 SMART
LRR 885 912 2.91e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000220448
AA Change: V87A

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000221280
Predicted Effect probably benign
Transcript: ENSMUST00000221659
AA Change: V795A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000222514
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,705,072 Y528F possibly damaging Het
Acad10 G A 5: 121,649,541 T115I possibly damaging Het
Adam19 T C 11: 46,127,265 F385L probably damaging Het
Adgb T C 10: 10,442,613 N162D probably benign Het
Arhgap20 C A 9: 51,846,270 P521T probably damaging Het
Arsa A T 15: 89,475,177 L134Q probably damaging Het
Atp5b A G 10: 128,090,052 Y508C probably damaging Het
AW554918 G A 18: 25,420,010 M287I probably benign Het
Bmp4 T C 14: 46,383,903 K395E probably damaging Het
Cacna2d4 A G 6: 119,300,333 Y669C probably damaging Het
Casq2 T C 3: 102,144,234 probably null Het
Cdk5rap1 A T 2: 154,360,599 I237N possibly damaging Het
Cerk G C 15: 86,149,364 S286C possibly damaging Het
Cir1 A C 2: 73,287,643 L186R probably damaging Het
Csf3r A T 4: 126,042,988 probably null Het
Cyp3a41a A T 5: 145,705,811 I246K possibly damaging Het
Cyp8b1 A G 9: 121,915,282 F328S possibly damaging Het
Dzank1 A T 2: 144,513,445 V110D probably benign Het
Gm13089 T C 4: 143,696,907 I437M possibly damaging Het
Gm6729 T A 10: 86,540,935 noncoding transcript Het
Gnpat T C 8: 124,877,507 F246L probably benign Het
Gnpat T A 8: 124,878,516 L248H probably damaging Het
Gstm7 T C 3: 107,926,950 T163A probably benign Het
Hspa5 A G 2: 34,775,098 T424A probably damaging Het
Itgb1 T G 8: 128,713,305 D158E probably damaging Het
Kif21a A G 15: 90,935,650 V1637A probably benign Het
Kl G T 5: 150,982,520 V452F probably damaging Het
Krt23 T C 11: 99,478,219 N416S probably benign Het
Lama4 A T 10: 39,092,245 H1461L possibly damaging Het
Lamc3 A G 2: 31,928,802 T1180A probably benign Het
Mboat2 T C 12: 24,946,528 Y145H probably damaging Het
Mlxipl T A 5: 135,113,710 I126N probably damaging Het
Myo16 T A 8: 10,570,181 N1577K possibly damaging Het
Olfr1039 A G 2: 86,131,571 F31L probably benign Het
Olfr414 A T 1: 174,431,135 K236* probably null Het
Pask A T 1: 93,330,827 D266E probably benign Het
Pcdhb17 A G 18: 37,486,846 Y563C probably damaging Het
Pdlim3 T A 8: 45,896,800 I49N probably damaging Het
Pla2g4c T A 7: 13,343,409 V292E possibly damaging Het
Prrt4 G T 6: 29,169,814 Q880K possibly damaging Het
Pygb A G 2: 150,786,938 D24G probably benign Het
R3hcc1l T A 19: 42,563,654 D363E probably damaging Het
Rif1 A C 2: 52,111,562 Q1676P probably benign Het
Ryr1 C A 7: 29,096,258 R1069L probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc2a13 A G 15: 91,412,160 V317A probably damaging Het
Slc35b4 A T 6: 34,161,684 F197I probably damaging Het
Tchhl1 G A 3: 93,470,213 V75I probably benign Het
Ubr4 T C 4: 139,455,460 S3521P possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp335 GTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTC 2: 164,907,468 probably benign Het
Zfp874a T G 13: 67,442,420 I382L possibly damaging Het
Other mutations in Nlrp4f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01608:Nlrp4f APN 13 65195543 nonsense probably null
IGL01676:Nlrp4f APN 13 65195119 missense possibly damaging 0.95
IGL01701:Nlrp4f APN 13 65199409 missense probably damaging 1.00
IGL01799:Nlrp4f APN 13 65187462 missense probably benign 0.03
IGL02084:Nlrp4f APN 13 65194171 nonsense probably null
IGL02234:Nlrp4f APN 13 65194488 missense probably damaging 1.00
IGL02481:Nlrp4f APN 13 65194734 missense probably benign 0.04
IGL02483:Nlrp4f APN 13 65194734 missense probably benign 0.04
IGL02625:Nlrp4f APN 13 65199271 missense probably damaging 1.00
IGL02814:Nlrp4f APN 13 65185042 missense probably damaging 0.98
IGL03077:Nlrp4f APN 13 65194598 missense probably benign 0.10
IGL03111:Nlrp4f APN 13 65183002 missense probably damaging 1.00
IGL03175:Nlrp4f APN 13 65194596 missense probably damaging 1.00
IGL03324:Nlrp4f APN 13 65195228 missense possibly damaging 0.91
R0398:Nlrp4f UTSW 13 65194918 missense possibly damaging 0.79
R0477:Nlrp4f UTSW 13 65190906 missense probably benign 0.01
R0707:Nlrp4f UTSW 13 65194503 missense probably benign 0.42
R1302:Nlrp4f UTSW 13 65194557 missense possibly damaging 0.77
R1460:Nlrp4f UTSW 13 65190268 missense probably benign 0.23
R1970:Nlrp4f UTSW 13 65194091 missense probably damaging 1.00
R2111:Nlrp4f UTSW 13 65199353 missense probably benign 0.11
R2272:Nlrp4f UTSW 13 65194408 missense probably benign 0.01
R2370:Nlrp4f UTSW 13 65190846 missense probably damaging 0.99
R2680:Nlrp4f UTSW 13 65194343 nonsense probably null
R3120:Nlrp4f UTSW 13 65194716 missense probably benign 0.13
R3737:Nlrp4f UTSW 13 65194007 missense probably benign 0.01
R4035:Nlrp4f UTSW 13 65194007 missense probably benign 0.01
R4107:Nlrp4f UTSW 13 65183065 missense probably benign 0.01
R4422:Nlrp4f UTSW 13 65184962 critical splice donor site probably null
R4718:Nlrp4f UTSW 13 65194989 missense probably benign 0.01
R5652:Nlrp4f UTSW 13 65182989 missense probably benign 0.00
R5656:Nlrp4f UTSW 13 65190871 nonsense probably null
R5912:Nlrp4f UTSW 13 65194908 missense probably damaging 0.99
R5915:Nlrp4f UTSW 13 65187555 missense probably damaging 1.00
R5955:Nlrp4f UTSW 13 65195081 missense probably benign 0.15
R6683:Nlrp4f UTSW 13 65199195 missense probably benign 0.01
R6742:Nlrp4f UTSW 13 65187440 critical splice donor site probably null
R6750:Nlrp4f UTSW 13 65181654 nonsense probably null
R6751:Nlrp4f UTSW 13 65194429 missense probably damaging 0.99
R7110:Nlrp4f UTSW 13 65199346 missense probably damaging 0.96
R7143:Nlrp4f UTSW 13 65195306 missense probably damaging 1.00
R7143:Nlrp4f UTSW 13 65199352 missense possibly damaging 0.90
R7187:Nlrp4f UTSW 13 65195387 missense possibly damaging 0.47
R7230:Nlrp4f UTSW 13 65194901 missense probably benign 0.16
R7283:Nlrp4f UTSW 13 65195538 nonsense probably null
R7501:Nlrp4f UTSW 13 65194329 missense probably damaging 0.99
R7863:Nlrp4f UTSW 13 65194245 missense possibly damaging 0.63
R7889:Nlrp4f UTSW 13 65195018 missense probably damaging 1.00
R8472:Nlrp4f UTSW 13 65194331 missense possibly damaging 0.87
R8553:Nlrp4f UTSW 13 65195438 missense possibly damaging 0.66
Z1088:Nlrp4f UTSW 13 65194302 missense probably benign 0.00
Z1177:Nlrp4f UTSW 13 65194661 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ttatcacaggaacaaaactgagac -3'
Posted On2014-01-05