Incidental Mutation 'R1052:Zfp874a'
ID94078
Institutional Source Beutler Lab
Gene Symbol Zfp874a
Ensembl Gene ENSMUSG00000069206
Gene Namezinc finger protein 874a
SynonymsZfp874, Rslcan15, C330011K17Rik
MMRRC Submission 039142-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R1052 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location67424549-67451624 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 67442420 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 382 (I382L)
Ref Sequence ENSEMBL: ENSMUSP00000074735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057241] [ENSMUST00000075255] [ENSMUST00000180580] [ENSMUST00000223682] [ENSMUST00000225479]
Predicted Effect probably benign
Transcript: ENSMUST00000057241
SMART Domains Protein: ENSMUSP00000077307
Gene: ENSMUSG00000069206

DomainStartEndE-ValueType
KRAB 5 65 1.73e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000075255
AA Change: I382L

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074735
Gene: ENSMUSG00000069206
AA Change: I382L

DomainStartEndE-ValueType
KRAB 5 65 1.73e-27 SMART
ZnF_C2H2 137 159 9.58e-3 SMART
ZnF_C2H2 165 187 5.99e-4 SMART
ZnF_C2H2 193 215 7.26e-3 SMART
ZnF_C2H2 221 243 2.4e-3 SMART
ZnF_C2H2 249 269 1.88e2 SMART
ZnF_C2H2 277 299 5.21e-4 SMART
ZnF_C2H2 305 327 2.12e-4 SMART
ZnF_C2H2 333 355 2.12e-4 SMART
ZnF_C2H2 361 383 8.47e-4 SMART
ZnF_C2H2 389 411 1.79e-2 SMART
ZnF_C2H2 417 438 2.86e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180580
SMART Domains Protein: ENSMUSP00000137953
Gene: ENSMUSG00000069206

DomainStartEndE-ValueType
KRAB 5 65 1.73e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224239
Predicted Effect probably benign
Transcript: ENSMUST00000225479
Predicted Effect probably benign
Transcript: ENSMUST00000225778
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,705,072 Y528F possibly damaging Het
Acad10 G A 5: 121,649,541 T115I possibly damaging Het
Adam19 T C 11: 46,127,265 F385L probably damaging Het
Adgb T C 10: 10,442,613 N162D probably benign Het
Arhgap20 C A 9: 51,846,270 P521T probably damaging Het
Arsa A T 15: 89,475,177 L134Q probably damaging Het
Atp5b A G 10: 128,090,052 Y508C probably damaging Het
AW554918 G A 18: 25,420,010 M287I probably benign Het
Bmp4 T C 14: 46,383,903 K395E probably damaging Het
Cacna2d4 A G 6: 119,300,333 Y669C probably damaging Het
Casq2 T C 3: 102,144,234 probably null Het
Cdk5rap1 A T 2: 154,360,599 I237N possibly damaging Het
Cerk G C 15: 86,149,364 S286C possibly damaging Het
Cir1 A C 2: 73,287,643 L186R probably damaging Het
Csf3r A T 4: 126,042,988 probably null Het
Cyp3a41a A T 5: 145,705,811 I246K possibly damaging Het
Cyp8b1 A G 9: 121,915,282 F328S possibly damaging Het
Dzank1 A T 2: 144,513,445 V110D probably benign Het
Gm13089 T C 4: 143,696,907 I437M possibly damaging Het
Gm6729 T A 10: 86,540,935 noncoding transcript Het
Gnpat T C 8: 124,877,507 F246L probably benign Het
Gnpat T A 8: 124,878,516 L248H probably damaging Het
Gstm7 T C 3: 107,926,950 T163A probably benign Het
Hspa5 A G 2: 34,775,098 T424A probably damaging Het
Itgb1 T G 8: 128,713,305 D158E probably damaging Het
Kif21a A G 15: 90,935,650 V1637A probably benign Het
Kl G T 5: 150,982,520 V452F probably damaging Het
Krt23 T C 11: 99,478,219 N416S probably benign Het
Lama4 A T 10: 39,092,245 H1461L possibly damaging Het
Lamc3 A G 2: 31,928,802 T1180A probably benign Het
Mboat2 T C 12: 24,946,528 Y145H probably damaging Het
Mlxipl T A 5: 135,113,710 I126N probably damaging Het
Myo16 T A 8: 10,570,181 N1577K possibly damaging Het
Nlrp4f A G 13: 65,185,083 V87A possibly damaging Het
Olfr1039 A G 2: 86,131,571 F31L probably benign Het
Olfr414 A T 1: 174,431,135 K236* probably null Het
Pask A T 1: 93,330,827 D266E probably benign Het
Pcdhb17 A G 18: 37,486,846 Y563C probably damaging Het
Pdlim3 T A 8: 45,896,800 I49N probably damaging Het
Pla2g4c T A 7: 13,343,409 V292E possibly damaging Het
Prrt4 G T 6: 29,169,814 Q880K possibly damaging Het
Pygb A G 2: 150,786,938 D24G probably benign Het
R3hcc1l T A 19: 42,563,654 D363E probably damaging Het
Rif1 A C 2: 52,111,562 Q1676P probably benign Het
Ryr1 C A 7: 29,096,258 R1069L probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc2a13 A G 15: 91,412,160 V317A probably damaging Het
Slc35b4 A T 6: 34,161,684 F197I probably damaging Het
Tchhl1 G A 3: 93,470,213 V75I probably benign Het
Ubr4 T C 4: 139,455,460 S3521P possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp335 GTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTC 2: 164,907,468 probably benign Het
Other mutations in Zfp874a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02490:Zfp874a APN 13 67442700 nonsense probably null
R1991:Zfp874a UTSW 13 67442504 missense probably benign 0.03
R2085:Zfp874a UTSW 13 67442848 missense probably damaging 1.00
R2103:Zfp874a UTSW 13 67442504 missense probably benign 0.03
R5129:Zfp874a UTSW 13 67442981 missense probably damaging 1.00
R5336:Zfp874a UTSW 13 67442680 missense probably damaging 1.00
R5423:Zfp874a UTSW 13 67442354 missense possibly damaging 0.75
R5713:Zfp874a UTSW 13 67449357 missense probably benign 0.16
R5855:Zfp874a UTSW 13 67442693 missense probably benign 0.03
R6496:Zfp874a UTSW 13 67442575 missense possibly damaging 0.62
R7046:Zfp874a UTSW 13 67442299 missense probably damaging 1.00
R7065:Zfp874a UTSW 13 67442282 missense probably damaging 0.97
R7233:Zfp874a UTSW 13 67442657 missense possibly damaging 0.83
R7271:Zfp874a UTSW 13 67443296 missense probably benign 0.00
R7465:Zfp874a UTSW 13 67442257 missense probably damaging 0.99
R7468:Zfp874a UTSW 13 67425604 utr 3 prime probably null
R8108:Zfp874a UTSW 13 67443234 nonsense probably null
X0063:Zfp874a UTSW 13 67442987 missense probably damaging 1.00
Z1177:Zfp874a UTSW 13 67442662 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCCTCAAGTCTCCTAAGAAATGAATGATAA -3'
(R):5'- AGTCGCTCATCACTTTTaatacaccagaaat -3'

Sequencing Primer
(F):5'- CTCCAGTATGAATTTCTAGATGTTCC -3'
(R):5'- caagtgtgaagaatgtgggaaag -3'
Posted On2014-01-05