Incidental Mutation 'R1052:Cerk'
ID94081
Institutional Source Beutler Lab
Gene Symbol Cerk
Ensembl Gene ENSMUSG00000035891
Gene Nameceramide kinase
Synonyms
MMRRC Submission 039142-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R1052 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location86139128-86186141 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 86149364 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 286 (S286C)
Ref Sequence ENSEMBL: ENSMUSP00000038203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044332] [ENSMUST00000156546]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044332
AA Change: S286C

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038203
Gene: ENSMUSG00000035891
AA Change: S286C

DomainStartEndE-ValueType
Blast:PH 8 126 9e-39 BLAST
Pfam:DAGK_cat 132 274 1.1e-31 PFAM
low complexity region 356 367 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150767
Predicted Effect probably benign
Transcript: ENSMUST00000156546
SMART Domains Protein: ENSMUSP00000119472
Gene: ENSMUSG00000035891

DomainStartEndE-ValueType
low complexity region 51 62 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157732
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CERK converts ceramide to ceramide 1-phosphate (C1P), a sphingolipid metabolite. Both CERK and C1P have been implicated in various cellular processes, including proliferation, apoptosis, phagocytosis, and inflammation (Kim et al., 2006 [PubMed 16488390]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced body weight, increased susceptibility to infection and decreased neutrophil numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,705,072 Y528F possibly damaging Het
Acad10 G A 5: 121,649,541 T115I possibly damaging Het
Adam19 T C 11: 46,127,265 F385L probably damaging Het
Adgb T C 10: 10,442,613 N162D probably benign Het
Arhgap20 C A 9: 51,846,270 P521T probably damaging Het
Arsa A T 15: 89,475,177 L134Q probably damaging Het
Atp5b A G 10: 128,090,052 Y508C probably damaging Het
AW554918 G A 18: 25,420,010 M287I probably benign Het
Bmp4 T C 14: 46,383,903 K395E probably damaging Het
Cacna2d4 A G 6: 119,300,333 Y669C probably damaging Het
Casq2 T C 3: 102,144,234 probably null Het
Cdk5rap1 A T 2: 154,360,599 I237N possibly damaging Het
Cir1 A C 2: 73,287,643 L186R probably damaging Het
Csf3r A T 4: 126,042,988 probably null Het
Cyp3a41a A T 5: 145,705,811 I246K possibly damaging Het
Cyp8b1 A G 9: 121,915,282 F328S possibly damaging Het
Dzank1 A T 2: 144,513,445 V110D probably benign Het
Gm13089 T C 4: 143,696,907 I437M possibly damaging Het
Gm6729 T A 10: 86,540,935 noncoding transcript Het
Gnpat T C 8: 124,877,507 F246L probably benign Het
Gnpat T A 8: 124,878,516 L248H probably damaging Het
Gstm7 T C 3: 107,926,950 T163A probably benign Het
Hspa5 A G 2: 34,775,098 T424A probably damaging Het
Itgb1 T G 8: 128,713,305 D158E probably damaging Het
Kif21a A G 15: 90,935,650 V1637A probably benign Het
Kl G T 5: 150,982,520 V452F probably damaging Het
Krt23 T C 11: 99,478,219 N416S probably benign Het
Lama4 A T 10: 39,092,245 H1461L possibly damaging Het
Lamc3 A G 2: 31,928,802 T1180A probably benign Het
Mboat2 T C 12: 24,946,528 Y145H probably damaging Het
Mlxipl T A 5: 135,113,710 I126N probably damaging Het
Myo16 T A 8: 10,570,181 N1577K possibly damaging Het
Nlrp4f A G 13: 65,185,083 V87A possibly damaging Het
Olfr1039 A G 2: 86,131,571 F31L probably benign Het
Olfr414 A T 1: 174,431,135 K236* probably null Het
Pask A T 1: 93,330,827 D266E probably benign Het
Pcdhb17 A G 18: 37,486,846 Y563C probably damaging Het
Pdlim3 T A 8: 45,896,800 I49N probably damaging Het
Pla2g4c T A 7: 13,343,409 V292E possibly damaging Het
Prrt4 G T 6: 29,169,814 Q880K possibly damaging Het
Pygb A G 2: 150,786,938 D24G probably benign Het
R3hcc1l T A 19: 42,563,654 D363E probably damaging Het
Rif1 A C 2: 52,111,562 Q1676P probably benign Het
Ryr1 C A 7: 29,096,258 R1069L probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc2a13 A G 15: 91,412,160 V317A probably damaging Het
Slc35b4 A T 6: 34,161,684 F197I probably damaging Het
Tchhl1 G A 3: 93,470,213 V75I probably benign Het
Ubr4 T C 4: 139,455,460 S3521P possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp335 GTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTC 2: 164,907,468 probably benign Het
Zfp874a T G 13: 67,442,420 I382L possibly damaging Het
Other mutations in Cerk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01414:Cerk APN 15 86159142 missense probably benign 0.02
IGL01653:Cerk APN 15 86149351 nonsense probably null
IGL01732:Cerk APN 15 86146316 missense possibly damaging 0.68
IGL03107:Cerk APN 15 86142813 missense probably benign 0.00
resnick UTSW 15 86156668 unclassified probably null
BB007:Cerk UTSW 15 86144719 missense not run
BB017:Cerk UTSW 15 86144719 missense not run
IGL02837:Cerk UTSW 15 86144695 nonsense probably null
R0318:Cerk UTSW 15 86151565 missense possibly damaging 0.89
R0517:Cerk UTSW 15 86156648 missense probably damaging 1.00
R1640:Cerk UTSW 15 86149400 missense probably damaging 0.98
R2049:Cerk UTSW 15 86142808 missense probably benign
R2885:Cerk UTSW 15 86142883 missense probably damaging 1.00
R3887:Cerk UTSW 15 86149331 missense possibly damaging 0.95
R3931:Cerk UTSW 15 86155110 nonsense probably null
R4033:Cerk UTSW 15 86155027 missense possibly damaging 0.47
R4234:Cerk UTSW 15 86142788 missense probably benign 0.00
R4945:Cerk UTSW 15 86156601 missense probably benign 0.44
R5742:Cerk UTSW 15 86141572 missense probably damaging 1.00
R6160:Cerk UTSW 15 86142773 missense probably benign 0.43
R6309:Cerk UTSW 15 86156668 unclassified probably null
R7002:Cerk UTSW 15 86156594 missense possibly damaging 0.56
R7360:Cerk UTSW 15 86159126 missense probably damaging 1.00
X0067:Cerk UTSW 15 86146346 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TGACTCTCAAGGGAGCATCATCTGG -3'
(R):5'- TTGCAGCAAGCAGACACCTCTGAC -3'

Sequencing Primer
(F):5'- GAGCATCATCTGGGTCACAC -3'
(R):5'- ACACCTTCAGGGTGCTGTC -3'
Posted On2014-01-05