Incidental Mutation 'R1052:AW554918'
ID94091
Institutional Source Beutler Lab
Gene Symbol AW554918
Ensembl Gene ENSMUSG00000033632
Gene Nameexpressed sequence AW554918
Synonyms
MMRRC Submission 039142-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1052 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location25168999-25467321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25420010 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 287 (M287I)
Ref Sequence ENSEMBL: ENSMUSP00000097708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036619] [ENSMUST00000097643] [ENSMUST00000100131] [ENSMUST00000159605] [ENSMUST00000160530] [ENSMUST00000165400]
Predicted Effect probably benign
Transcript: ENSMUST00000036619
AA Change: M490I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046227
Gene: ENSMUSG00000033632
AA Change: M490I

DomainStartEndE-ValueType
Pfam:KIAA1328 92 414 1.4e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097643
AA Change: M523I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095248
Gene: ENSMUSG00000033632
AA Change: M523I

DomainStartEndE-ValueType
Pfam:KIAA1328 92 414 2.5e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100131
AA Change: M287I

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000097708
Gene: ENSMUSG00000033632
AA Change: M287I

DomainStartEndE-ValueType
Pfam:KIAA1328 1 211 9.6e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159605
Predicted Effect probably benign
Transcript: ENSMUST00000160530
Predicted Effect probably benign
Transcript: ENSMUST00000165400
AA Change: M523I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128437
Gene: ENSMUSG00000033632
AA Change: M523I

DomainStartEndE-ValueType
Pfam:KIAA1328 92 414 1.6e-160 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,705,072 Y528F possibly damaging Het
Acad10 G A 5: 121,649,541 T115I possibly damaging Het
Adam19 T C 11: 46,127,265 F385L probably damaging Het
Adgb T C 10: 10,442,613 N162D probably benign Het
Arhgap20 C A 9: 51,846,270 P521T probably damaging Het
Arsa A T 15: 89,475,177 L134Q probably damaging Het
Atp5b A G 10: 128,090,052 Y508C probably damaging Het
Bmp4 T C 14: 46,383,903 K395E probably damaging Het
Cacna2d4 A G 6: 119,300,333 Y669C probably damaging Het
Casq2 T C 3: 102,144,234 probably null Het
Cdk5rap1 A T 2: 154,360,599 I237N possibly damaging Het
Cerk G C 15: 86,149,364 S286C possibly damaging Het
Cir1 A C 2: 73,287,643 L186R probably damaging Het
Csf3r A T 4: 126,042,988 probably null Het
Cyp3a41a A T 5: 145,705,811 I246K possibly damaging Het
Cyp8b1 A G 9: 121,915,282 F328S possibly damaging Het
Dzank1 A T 2: 144,513,445 V110D probably benign Het
Gm13089 T C 4: 143,696,907 I437M possibly damaging Het
Gm6729 T A 10: 86,540,935 noncoding transcript Het
Gnpat T C 8: 124,877,507 F246L probably benign Het
Gnpat T A 8: 124,878,516 L248H probably damaging Het
Gstm7 T C 3: 107,926,950 T163A probably benign Het
Hspa5 A G 2: 34,775,098 T424A probably damaging Het
Itgb1 T G 8: 128,713,305 D158E probably damaging Het
Kif21a A G 15: 90,935,650 V1637A probably benign Het
Kl G T 5: 150,982,520 V452F probably damaging Het
Krt23 T C 11: 99,478,219 N416S probably benign Het
Lama4 A T 10: 39,092,245 H1461L possibly damaging Het
Lamc3 A G 2: 31,928,802 T1180A probably benign Het
Mboat2 T C 12: 24,946,528 Y145H probably damaging Het
Mlxipl T A 5: 135,113,710 I126N probably damaging Het
Myo16 T A 8: 10,570,181 N1577K possibly damaging Het
Nlrp4f A G 13: 65,185,083 V87A possibly damaging Het
Olfr1039 A G 2: 86,131,571 F31L probably benign Het
Olfr414 A T 1: 174,431,135 K236* probably null Het
Pask A T 1: 93,330,827 D266E probably benign Het
Pcdhb17 A G 18: 37,486,846 Y563C probably damaging Het
Pdlim3 T A 8: 45,896,800 I49N probably damaging Het
Pla2g4c T A 7: 13,343,409 V292E possibly damaging Het
Prrt4 G T 6: 29,169,814 Q880K possibly damaging Het
Pygb A G 2: 150,786,938 D24G probably benign Het
R3hcc1l T A 19: 42,563,654 D363E probably damaging Het
Rif1 A C 2: 52,111,562 Q1676P probably benign Het
Ryr1 C A 7: 29,096,258 R1069L probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc2a13 A G 15: 91,412,160 V317A probably damaging Het
Slc35b4 A T 6: 34,161,684 F197I probably damaging Het
Tchhl1 G A 3: 93,470,213 V75I probably benign Het
Ubr4 T C 4: 139,455,460 S3521P possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp335 GTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTC 2: 164,907,468 probably benign Het
Zfp874a T G 13: 67,442,420 I382L possibly damaging Het
Other mutations in AW554918
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:AW554918 APN 18 25420065 nonsense probably null
IGL01443:AW554918 APN 18 25344955 missense probably damaging 1.00
IGL01973:AW554918 APN 18 25419999 missense probably damaging 1.00
IGL02743:AW554918 APN 18 25289944 nonsense probably null
PIT4802001:AW554918 UTSW 18 25340075 missense possibly damaging 0.90
R0081:AW554918 UTSW 18 25344902 missense probably benign 0.00
R0567:AW554918 UTSW 18 25400035 missense possibly damaging 0.83
R0709:AW554918 UTSW 18 25463654 missense probably damaging 1.00
R1418:AW554918 UTSW 18 25339699 splice site probably null
R1530:AW554918 UTSW 18 25400104 missense probably damaging 0.97
R2406:AW554918 UTSW 18 25340287 missense possibly damaging 0.95
R3414:AW554918 UTSW 18 25400072 missense possibly damaging 0.76
R3815:AW554918 UTSW 18 25400047 missense probably benign 0.42
R4683:AW554918 UTSW 18 25339795 missense probably benign 0.04
R4722:AW554918 UTSW 18 25174715 nonsense probably null
R4843:AW554918 UTSW 18 25340000 missense probably benign 0.00
R5199:AW554918 UTSW 18 25340299 missense probably damaging 1.00
R5279:AW554918 UTSW 18 25175431 missense possibly damaging 0.95
R5580:AW554918 UTSW 18 25339865 missense probably damaging 1.00
R7259:AW554918 UTSW 18 25289849 intron probably null
R7388:AW554918 UTSW 18 25340113 missense probably benign 0.05
R7399:AW554918 UTSW 18 25169060 missense possibly damaging 0.67
R8249:AW554918 UTSW 18 25339718 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GGGCATTTTCATAGCGAACCCAAATC -3'
(R):5'- GCTGCTAAGCAGAGTTTCTGTGGAC -3'

Sequencing Primer
(F):5'- TTAAGTAAGGCGATGTGAATCACTG -3'
(R):5'- CTATGGAAATCCTTGTCAACTGTC -3'
Posted On2014-01-05