Incidental Mutation 'R1052:R3hcc1l'
ID94093
Institutional Source Beutler Lab
Gene Symbol R3hcc1l
Ensembl Gene ENSMUSG00000025184
Gene NameR3H domain and coiled-coil containing 1 like
SynonymsD19Ertd386e, 1700036B12Rik
MMRRC Submission 039142-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1052 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location42518759-42592343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42563654 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 363 (D363E)
Ref Sequence ENSEMBL: ENSMUSP00000026188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026188] [ENSMUST00000160107] [ENSMUST00000160893]
Predicted Effect probably damaging
Transcript: ENSMUST00000026188
AA Change: D363E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026188
Gene: ENSMUSG00000025184
AA Change: D363E

DomainStartEndE-ValueType
low complexity region 163 178 N/A INTRINSIC
low complexity region 694 706 N/A INTRINSIC
coiled coil region 734 766 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160107
SMART Domains Protein: ENSMUSP00000124036
Gene: ENSMUSG00000025184

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
coiled coil region 154 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160893
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162829
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,705,072 Y528F possibly damaging Het
Acad10 G A 5: 121,649,541 T115I possibly damaging Het
Adam19 T C 11: 46,127,265 F385L probably damaging Het
Adgb T C 10: 10,442,613 N162D probably benign Het
Arhgap20 C A 9: 51,846,270 P521T probably damaging Het
Arsa A T 15: 89,475,177 L134Q probably damaging Het
Atp5b A G 10: 128,090,052 Y508C probably damaging Het
AW554918 G A 18: 25,420,010 M287I probably benign Het
Bmp4 T C 14: 46,383,903 K395E probably damaging Het
Cacna2d4 A G 6: 119,300,333 Y669C probably damaging Het
Casq2 T C 3: 102,144,234 probably null Het
Cdk5rap1 A T 2: 154,360,599 I237N possibly damaging Het
Cerk G C 15: 86,149,364 S286C possibly damaging Het
Cir1 A C 2: 73,287,643 L186R probably damaging Het
Csf3r A T 4: 126,042,988 probably null Het
Cyp3a41a A T 5: 145,705,811 I246K possibly damaging Het
Cyp8b1 A G 9: 121,915,282 F328S possibly damaging Het
Dzank1 A T 2: 144,513,445 V110D probably benign Het
Gm13089 T C 4: 143,696,907 I437M possibly damaging Het
Gm6729 T A 10: 86,540,935 noncoding transcript Het
Gnpat T C 8: 124,877,507 F246L probably benign Het
Gnpat T A 8: 124,878,516 L248H probably damaging Het
Gstm7 T C 3: 107,926,950 T163A probably benign Het
Hspa5 A G 2: 34,775,098 T424A probably damaging Het
Itgb1 T G 8: 128,713,305 D158E probably damaging Het
Kif21a A G 15: 90,935,650 V1637A probably benign Het
Kl G T 5: 150,982,520 V452F probably damaging Het
Krt23 T C 11: 99,478,219 N416S probably benign Het
Lama4 A T 10: 39,092,245 H1461L possibly damaging Het
Lamc3 A G 2: 31,928,802 T1180A probably benign Het
Mboat2 T C 12: 24,946,528 Y145H probably damaging Het
Mlxipl T A 5: 135,113,710 I126N probably damaging Het
Myo16 T A 8: 10,570,181 N1577K possibly damaging Het
Nlrp4f A G 13: 65,185,083 V87A possibly damaging Het
Olfr1039 A G 2: 86,131,571 F31L probably benign Het
Olfr414 A T 1: 174,431,135 K236* probably null Het
Pask A T 1: 93,330,827 D266E probably benign Het
Pcdhb17 A G 18: 37,486,846 Y563C probably damaging Het
Pdlim3 T A 8: 45,896,800 I49N probably damaging Het
Pla2g4c T A 7: 13,343,409 V292E possibly damaging Het
Prrt4 G T 6: 29,169,814 Q880K possibly damaging Het
Pygb A G 2: 150,786,938 D24G probably benign Het
Rif1 A C 2: 52,111,562 Q1676P probably benign Het
Ryr1 C A 7: 29,096,258 R1069L probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc2a13 A G 15: 91,412,160 V317A probably damaging Het
Slc35b4 A T 6: 34,161,684 F197I probably damaging Het
Tchhl1 G A 3: 93,470,213 V75I probably benign Het
Ubr4 T C 4: 139,455,460 S3521P possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp335 GTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTC 2: 164,907,468 probably benign Het
Zfp874a T G 13: 67,442,420 I382L possibly damaging Het
Other mutations in R3hcc1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:R3hcc1l APN 19 42563952 missense probably benign 0.04
IGL01731:R3hcc1l APN 19 42562801 missense probably benign 0.01
IGL01921:R3hcc1l APN 19 42563781 missense possibly damaging 0.87
IGL01933:R3hcc1l APN 19 42562950 missense probably damaging 0.99
IGL02047:R3hcc1l APN 19 42563819 missense probably benign 0.20
IGL02658:R3hcc1l APN 19 42562702 missense probably damaging 0.99
IGL02952:R3hcc1l APN 19 42563994 missense probably damaging 0.97
R0233:R3hcc1l UTSW 19 42582921 critical splice donor site probably null
R0233:R3hcc1l UTSW 19 42582921 critical splice donor site probably null
R0254:R3hcc1l UTSW 19 42563148 missense probably damaging 1.00
R0285:R3hcc1l UTSW 19 42576129 missense probably damaging 1.00
R0483:R3hcc1l UTSW 19 42562556 utr 5 prime probably benign
R0727:R3hcc1l UTSW 19 42576075 missense probably damaging 1.00
R1061:R3hcc1l UTSW 19 42583426 nonsense probably null
R1570:R3hcc1l UTSW 19 42581954 missense probably damaging 1.00
R1641:R3hcc1l UTSW 19 42563607 missense possibly damaging 0.87
R2378:R3hcc1l UTSW 19 42563473 missense probably damaging 0.99
R2696:R3hcc1l UTSW 19 42563988 missense possibly damaging 0.94
R3051:R3hcc1l UTSW 19 42562625 nonsense probably null
R3053:R3hcc1l UTSW 19 42562625 nonsense probably null
R4471:R3hcc1l UTSW 19 42582820 splice site probably benign
R4643:R3hcc1l UTSW 19 42562800 missense probably benign 0.09
R4772:R3hcc1l UTSW 19 42583557 splice site probably benign
R5524:R3hcc1l UTSW 19 42563868 nonsense probably null
R5976:R3hcc1l UTSW 19 42563350 missense probably benign 0.06
R6965:R3hcc1l UTSW 19 42562845 missense probably damaging 1.00
R7086:R3hcc1l UTSW 19 42581970 missense probably damaging 0.99
R7158:R3hcc1l UTSW 19 42583429 missense probably damaging 1.00
R7317:R3hcc1l UTSW 19 42583540 nonsense probably null
R7447:R3hcc1l UTSW 19 42562662 missense probably benign 0.02
R7792:R3hcc1l UTSW 19 42563964 missense probably damaging 0.96
R8222:R3hcc1l UTSW 19 42576177 missense probably damaging 1.00
X0064:R3hcc1l UTSW 19 42583545 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACACCAGATGGGATGTCAAAGCAC -3'
(R):5'- TGAGCAAGCACTTAGGCTGCTAATG -3'

Sequencing Primer
(F):5'- CAACAGTACAGAGTCTGTCTTGG -3'
(R):5'- AGTGGAGCTACATCTGCACTC -3'
Posted On2014-01-05