Incidental Mutation 'R1053:Cds2'
ID94101
Institutional Source Beutler Lab
Gene Symbol Cds2
Ensembl Gene ENSMUSG00000058793
Gene NameCDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
Synonyms5730460C18Rik, 5730450N06Rik, D2Wsu127e
MMRRC Submission 039143-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1053 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location132263148-132312050 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 132305260 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 420 (L420Q)
Ref Sequence ENSEMBL: ENSMUSP00000086886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089461] [ENSMUST00000103181]
Predicted Effect probably damaging
Transcript: ENSMUST00000089461
AA Change: L420Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086886
Gene: ENSMUSG00000058793
AA Change: L420Q

DomainStartEndE-ValueType
Pfam:CTP_transf_1 52 382 5e-90 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103181
AA Change: L437Q

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099470
Gene: ENSMUSG00000058793
AA Change: L437Q

DomainStartEndE-ValueType
Pfam:CTP_transf_1 69 399 7.6e-90 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000138194
AA Change: L186Q
SMART Domains Protein: ENSMUSP00000121769
Gene: ENSMUSG00000058793
AA Change: L186Q

DomainStartEndE-ValueType
Pfam:CTP_transf_1 3 126 8.7e-34 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Breakdown products of phosphoinositides are ubiquitous second messengers that function downstream of many G protein-coupled receptors and tyrosine kinases regulating cell growth, calcium metabolism, and protein kinase C activity. This gene encodes an enzyme which regulates the amount of phosphatidylinositol available for signaling by catalyzing the conversion of phosphatidic acid to CDP-diacylglycerol. This enzyme is an integral membrane protein localized to two subcellular domains, the matrix side of the inner mitochondrial membrane where it is thought to be involved in the synthesis of phosphatidylglycerol and cardiolipin and the cytoplasmic side of the endoplasmic reticulum where it functions in phosphatidylinositol biosynthesis. Two genes encoding this enzyme have been identified in humans, one mapping to human chromosome 4q21 and a second to 20p13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a lethal phenotype. Heterozygotes show a distorted lymphocyte distribution and enhanced sensorimotor gating. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A T 8: 40,754,731 N345Y probably benign Het
Ampd3 G A 7: 110,788,680 G107S probably damaging Het
Bcas3 T A 11: 85,557,410 I632N probably benign Het
Cald1 G T 6: 34,755,642 R83L probably damaging Het
Col6a1 A T 10: 76,720,966 Y266N probably damaging Het
Ctps A G 4: 120,543,722 probably null Het
Enam A G 5: 88,504,019 N1129S possibly damaging Het
Erc1 T C 6: 119,796,926 E356G probably damaging Het
Fbxl4 T A 4: 22,427,166 V469E probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm11568 A G 11: 99,858,061 T31A unknown Het
Grm2 T G 9: 106,648,157 Y453S probably damaging Het
Htt A G 5: 34,851,217 probably null Het
Jakmip1 A G 5: 37,134,249 I681V possibly damaging Het
Lair1 A G 7: 4,028,785 S108P probably damaging Het
Lrp12 A C 15: 39,877,981 F446C probably damaging Het
Ncoa6 C T 2: 155,434,040 R95Q probably damaging Het
Nup210 T C 6: 91,028,811 T614A probably benign Het
Olfr362 T C 2: 37,105,464 Y62C probably damaging Het
Olfr551 A T 7: 102,587,959 Y261* probably null Het
Olfr874 T C 9: 37,746,835 S234P probably damaging Het
Ppp1r12a T C 10: 108,262,351 S311P probably damaging Het
Rsph3a C A 17: 7,945,904 P32Q probably benign Het
Sorl1 T C 9: 41,991,456 T1602A probably benign Het
Svil C G 18: 5,056,690 P521R probably benign Het
Vps13b A G 15: 35,652,363 Y1580C probably damaging Het
Vwce T C 19: 10,664,099 F730L probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zc2hc1c A G 12: 85,296,556 D489G probably damaging Het
Other mutations in Cds2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cds2 APN 2 132297293 missense probably damaging 1.00
IGL00434:Cds2 APN 2 132293351 missense probably damaging 0.99
IGL00771:Cds2 APN 2 132304352 splice site probably benign
IGL00984:Cds2 APN 2 132298521 missense probably benign 0.02
IGL02041:Cds2 APN 2 132294443 missense possibly damaging 0.94
sugarless UTSW 2 132298483 missense probably damaging 1.00
R0045:Cds2 UTSW 2 132305155 missense possibly damaging 0.67
R0045:Cds2 UTSW 2 132305155 missense possibly damaging 0.67
R0452:Cds2 UTSW 2 132298479 missense probably damaging 0.99
R0455:Cds2 UTSW 2 132285967 critical splice donor site probably null
R0593:Cds2 UTSW 2 132297376 unclassified probably benign
R0831:Cds2 UTSW 2 132285967 critical splice donor site probably null
R1669:Cds2 UTSW 2 132295519 splice site probably null
R1740:Cds2 UTSW 2 132302213 missense possibly damaging 0.63
R1859:Cds2 UTSW 2 132302195 missense probably damaging 1.00
R4125:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4126:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4128:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4352:Cds2 UTSW 2 132263445 start codon destroyed probably null 0.37
R4467:Cds2 UTSW 2 132294446 nonsense probably null
R4698:Cds2 UTSW 2 132304953 missense probably damaging 0.97
R4704:Cds2 UTSW 2 132300602 nonsense probably null
R4917:Cds2 UTSW 2 132298478 missense probably damaging 0.98
R5070:Cds2 UTSW 2 132302088 nonsense probably null
R5199:Cds2 UTSW 2 132298483 missense probably damaging 1.00
R5431:Cds2 UTSW 2 132302170 missense probably benign 0.28
R5704:Cds2 UTSW 2 132293329 missense probably benign 0.01
R5858:Cds2 UTSW 2 132302113 missense probably benign 0.00
R5946:Cds2 UTSW 2 132297248 missense probably damaging 1.00
R5954:Cds2 UTSW 2 132297271 missense probably benign 0.00
R7195:Cds2 UTSW 2 132293284 missense probably benign 0.28
R7234:Cds2 UTSW 2 132304480 critical splice donor site probably null
R7413:Cds2 UTSW 2 132293315 missense probably benign 0.03
R7983:Cds2 UTSW 2 132263510 splice site probably null
Predicted Primers PCR Primer
(F):5'- CGCTTTGACTGCCAGTACCTGATG -3'
(R):5'- CAATGTATGATCTCTCGCACAGCCC -3'

Sequencing Primer
(F):5'- AGCTTTATCAGGTGCGGAACTAC -3'
(R):5'- CAGAAACCCAAATGGTTCTTTCCTG -3'
Posted On2014-01-05