Incidental Mutation 'R1053:Ctps'
ID94108
Institutional Source Beutler Lab
Gene Symbol Ctps
Ensembl Gene ENSMUSG00000028633
Gene Namecytidine 5'-triphosphate synthase
Synonyms
MMRRC Submission 039143-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R1053 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location120539868-120570276 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 120543722 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030381]
Predicted Effect probably null
Transcript: ENSMUST00000030381
SMART Domains Protein: ENSMUSP00000030381
Gene: ENSMUSG00000028633

DomainStartEndE-ValueType
Pfam:CTP_synth_N 2 277 2.8e-135 PFAM
Pfam:GATase 309 546 6.7e-55 PFAM
Pfam:Peptidase_C26 378 528 3.8e-10 PFAM
low complexity region 565 578 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147980
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme responsible for the catalytic conversion of UTP (uridine triphosphate) to CTP (cytidine triphospate). This reaction is an important step in the biosynthesis of phospholipids and nucleic acids. Activity of this proten is important in the immune system, and loss of function of this gene has been associated with immunodeficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A T 8: 40,754,731 N345Y probably benign Het
Ampd3 G A 7: 110,788,680 G107S probably damaging Het
Bcas3 T A 11: 85,557,410 I632N probably benign Het
Cald1 G T 6: 34,755,642 R83L probably damaging Het
Cds2 T A 2: 132,305,260 L420Q probably damaging Het
Col6a1 A T 10: 76,720,966 Y266N probably damaging Het
Enam A G 5: 88,504,019 N1129S possibly damaging Het
Erc1 T C 6: 119,796,926 E356G probably damaging Het
Fbxl4 T A 4: 22,427,166 V469E probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm11568 A G 11: 99,858,061 T31A unknown Het
Grm2 T G 9: 106,648,157 Y453S probably damaging Het
Htt A G 5: 34,851,217 probably null Het
Jakmip1 A G 5: 37,134,249 I681V possibly damaging Het
Lair1 A G 7: 4,028,785 S108P probably damaging Het
Lrp12 A C 15: 39,877,981 F446C probably damaging Het
Ncoa6 C T 2: 155,434,040 R95Q probably damaging Het
Nup210 T C 6: 91,028,811 T614A probably benign Het
Olfr362 T C 2: 37,105,464 Y62C probably damaging Het
Olfr551 A T 7: 102,587,959 Y261* probably null Het
Olfr874 T C 9: 37,746,835 S234P probably damaging Het
Ppp1r12a T C 10: 108,262,351 S311P probably damaging Het
Rsph3a C A 17: 7,945,904 P32Q probably benign Het
Sorl1 T C 9: 41,991,456 T1602A probably benign Het
Svil C G 18: 5,056,690 P521R probably benign Het
Vps13b A G 15: 35,652,363 Y1580C probably damaging Het
Vwce T C 19: 10,664,099 F730L probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zc2hc1c A G 12: 85,296,556 D489G probably damaging Het
Other mutations in Ctps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Ctps APN 4 120552944 missense probably damaging 1.00
IGL00919:Ctps APN 4 120567348 missense probably benign 0.03
IGL01510:Ctps APN 4 120558844 missense probably damaging 0.98
IGL01686:Ctps APN 4 120553986 missense probably benign
IGL01897:Ctps APN 4 120567279 missense probably damaging 1.00
IGL02261:Ctps APN 4 120542579 missense possibly damaging 0.53
IGL02797:Ctps APN 4 120562824 missense probably benign 0.03
R0125:Ctps UTSW 4 120561525 splice site probably benign
R2087:Ctps UTSW 4 120562815 missense probably benign 0.12
R3736:Ctps UTSW 4 120543746 missense probably benign
R3928:Ctps UTSW 4 120541896 missense probably benign
R3929:Ctps UTSW 4 120541896 missense probably benign
R4193:Ctps UTSW 4 120548138 missense probably damaging 1.00
R4389:Ctps UTSW 4 120558790 missense probably damaging 1.00
R4853:Ctps UTSW 4 120554010 missense probably damaging 1.00
R5045:Ctps UTSW 4 120552878 critical splice donor site probably null
R5074:Ctps UTSW 4 120553973 missense probably damaging 1.00
R5566:Ctps UTSW 4 120554103 splice site probably null
R6235:Ctps UTSW 4 120558806 missense probably benign 0.42
R6828:Ctps UTSW 4 120548138 missense probably damaging 1.00
R7232:Ctps UTSW 4 120548124 missense probably damaging 1.00
R7487:Ctps UTSW 4 120558800 missense probably damaging 1.00
X0027:Ctps UTSW 4 120554093 missense probably damaging 1.00
X0062:Ctps UTSW 4 120542617 missense probably benign
Z1176:Ctps UTSW 4 120542743 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGGGCATTTTCCTCATCCAATTCC -3'
(R):5'- GGTCTGGCTCTAGCAGAAGCAAAG -3'

Sequencing Primer
(F):5'- CAATGGCTTTAACCTAATGGCCTG -3'
(R):5'- CTCTAGCAGAAGCAAAGTTTGG -3'
Posted On2014-01-05