Incidental Mutation 'R1053:Lrp12'
ID94144
Institutional Source Beutler Lab
Gene Symbol Lrp12
Ensembl Gene ENSMUSG00000022305
Gene Namelow density lipoprotein-related protein 12
Synonyms
MMRRC Submission 039143-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R1053 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location39870589-39943994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 39877981 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 446 (F446C)
Ref Sequence ENSEMBL: ENSMUSP00000105934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022916] [ENSMUST00000110305] [ENSMUST00000228575]
Predicted Effect probably damaging
Transcript: ENSMUST00000022916
AA Change: F465C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022916
Gene: ENSMUSG00000022305
AA Change: F465C

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
CUB 47 159 3.23e-28 SMART
LDLa 167 202 1.27e-11 SMART
LDLa 214 256 1.04e-7 SMART
CUB 259 372 9.88e-24 SMART
LDLa 374 412 2.6e-3 SMART
LDLa 413 450 2.36e-6 SMART
LDLa 451 487 5.1e-11 SMART
low complexity region 630 646 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 708 722 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110305
AA Change: F446C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105934
Gene: ENSMUSG00000022305
AA Change: F446C

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CUB 28 140 3.23e-28 SMART
LDLa 148 183 1.27e-11 SMART
LDLa 195 237 1.04e-7 SMART
CUB 240 353 9.88e-24 SMART
LDLa 355 393 2.6e-3 SMART
LDLa 394 431 2.36e-6 SMART
LDLa 432 468 5.1e-11 SMART
low complexity region 611 627 N/A INTRINSIC
low complexity region 634 645 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228575
Meta Mutation Damage Score 0.4994 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low-density lipoprotein receptor related protein family. The product of this gene is a transmembrane protein that is differentially expressed in many cancer cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A T 8: 40,754,731 N345Y probably benign Het
Ampd3 G A 7: 110,788,680 G107S probably damaging Het
Bcas3 T A 11: 85,557,410 I632N probably benign Het
Cald1 G T 6: 34,755,642 R83L probably damaging Het
Cds2 T A 2: 132,305,260 L420Q probably damaging Het
Col6a1 A T 10: 76,720,966 Y266N probably damaging Het
Ctps A G 4: 120,543,722 probably null Het
Enam A G 5: 88,504,019 N1129S possibly damaging Het
Erc1 T C 6: 119,796,926 E356G probably damaging Het
Fbxl4 T A 4: 22,427,166 V469E probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm11568 A G 11: 99,858,061 T31A unknown Het
Grm2 T G 9: 106,648,157 Y453S probably damaging Het
Htt A G 5: 34,851,217 probably null Het
Jakmip1 A G 5: 37,134,249 I681V possibly damaging Het
Lair1 A G 7: 4,028,785 S108P probably damaging Het
Ncoa6 C T 2: 155,434,040 R95Q probably damaging Het
Nup210 T C 6: 91,028,811 T614A probably benign Het
Olfr362 T C 2: 37,105,464 Y62C probably damaging Het
Olfr551 A T 7: 102,587,959 Y261* probably null Het
Olfr874 T C 9: 37,746,835 S234P probably damaging Het
Ppp1r12a T C 10: 108,262,351 S311P probably damaging Het
Rsph3a C A 17: 7,945,904 P32Q probably benign Het
Sorl1 T C 9: 41,991,456 T1602A probably benign Het
Svil C G 18: 5,056,690 P521R probably benign Het
Vps13b A G 15: 35,652,363 Y1580C probably damaging Het
Vwce T C 19: 10,664,099 F730L probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zc2hc1c A G 12: 85,296,556 D489G probably damaging Het
Other mutations in Lrp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01953:Lrp12 APN 15 39878101 missense probably damaging 1.00
IGL02501:Lrp12 APN 15 39877904 missense probably damaging 1.00
IGL02850:Lrp12 APN 15 39878575 missense probably damaging 1.00
IGL03365:Lrp12 APN 15 39872521 missense probably benign
R0010:Lrp12 UTSW 15 39878276 missense probably damaging 1.00
R0047:Lrp12 UTSW 15 39878239 missense probably damaging 1.00
R0416:Lrp12 UTSW 15 39878911 splice site probably benign
R0840:Lrp12 UTSW 15 39876158 missense probably damaging 1.00
R1158:Lrp12 UTSW 15 39878431 missense probably damaging 1.00
R1288:Lrp12 UTSW 15 39878403 missense probably damaging 1.00
R1350:Lrp12 UTSW 15 39878250 nonsense probably null
R1416:Lrp12 UTSW 15 39878623 missense probably damaging 1.00
R1548:Lrp12 UTSW 15 39872506 missense probably damaging 0.99
R1691:Lrp12 UTSW 15 39872265 missense probably damaging 1.00
R1696:Lrp12 UTSW 15 39878361 missense probably damaging 0.99
R2050:Lrp12 UTSW 15 39872589 missense probably damaging 0.99
R2513:Lrp12 UTSW 15 39876111 missense probably damaging 1.00
R3415:Lrp12 UTSW 15 39878282 missense probably damaging 1.00
R3417:Lrp12 UTSW 15 39878282 missense probably damaging 1.00
R4118:Lrp12 UTSW 15 39877965 nonsense probably null
R4167:Lrp12 UTSW 15 39885013 missense probably damaging 1.00
R4214:Lrp12 UTSW 15 39872580 missense probably benign 0.33
R4643:Lrp12 UTSW 15 39872022 missense probably damaging 1.00
R5008:Lrp12 UTSW 15 39878456 missense probably damaging 1.00
R5061:Lrp12 UTSW 15 39878254 missense probably damaging 1.00
R5165:Lrp12 UTSW 15 39872461 missense probably benign
R5910:Lrp12 UTSW 15 39876043 intron probably null
R6038:Lrp12 UTSW 15 39872380 missense probably damaging 0.99
R6038:Lrp12 UTSW 15 39872380 missense probably damaging 0.99
R6047:Lrp12 UTSW 15 39872067 missense probably damaging 1.00
R6351:Lrp12 UTSW 15 39878188 missense probably damaging 1.00
R6392:Lrp12 UTSW 15 39872019 missense probably damaging 1.00
R7026:Lrp12 UTSW 15 39880170 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACCCCAATGCAATGACGAG -3'
(R):5'- CGCTACTTACCAAGTCGATGGCTTC -3'

Sequencing Primer
(F):5'- GCAGCAGGCCACAGATG -3'
(R):5'- GGTACTGGCATTGCCCAAAC -3'
Posted On2014-01-05